Description :
From Genome Similarity Track
Location :
Scaffold_131:40406- 43908
Sequence
3502 bases(100 bases per row)
GAAAAGAAGGGGAGAATTTCCTGTTGTGGATCAGAGAGGTGTAAATGGCCATGAACTCCACTATGCTCAAGTCGAAGCAACAACGAGTTGGGATGAATAT
CTCAGAATTAGGTAGTCATACCAGAGACTGGGCTTTCACATGTAGCACGTCTGTTGACGAGATTTTCCCCACATGGGATTTGCTAAAACAGCAAAAATTT
CGGGTGTGTTGCTCCGCCTAATCGGGCATATCGATTGCATTCCCGCTTCCTATTTTCCCATCAGGGCAAGAAAGAACTATCGGACTATGTCCAGGAGCTG
AAAACTCTAATCGCTGCCATGCAGATTGACCCCTTACCATTAATGGTTCTGGTTATCATCTTCACGGAGGGTCTTCGTACTGGCATGGCTTGAACGGAAG
TATTCTGGGTCCACCCACCTCTTTTGAGGCGGCTTTGGATATCGCGTTGGACGCTGATTTCAACATTAGGGCAGCCCTTTGTTTCACCCATTGGTACAAC
CCAAACTCGGCGAACTCATTCAGTTCGTTCAATAGGCCGGAGCCTGTGGACCCCAGTCTTGCCGAGACGGGCGAAGAAGCAGAGCTTCGAGCTGTAGAAC
AACATTTTAACATTCGACATTGTTTCGCGTACCAAAGCAGAAAGCGCCTGCGACCTAATTGCCCTTTACGGGCACGCCAGGCTTCTTCAAGCCGAACTCC
CGCCGCAACCCAGAAGTCTGGCACGGTGCGGGAAAACGTAGAATACCAGTAGGCATAGGGCGCCTTGATGGGGAAGAACTAGGTTCTGTAGAACCTCTAG
GAGGTATTAACAAACATCACCTAGCCCCAAGGAGCTCCGTGCACTCTAACACGGGGCGAGAATACAAGCCAGGGTTGTTGGTTGCGAAAGCGAGTGTCAA
GAGCTTTGATAAACTCTGGTCGATTTTGATCGACTCTGGTGCATCCGGTAATTAGTCAGACGATGTTCCCTGGAAGGGAATCCACGTTATGTTGAGGAGC
TAGAATCGCACAAGGGTGATACGATCACTGTTCACTTAGCGACAGGGACTCTAGTCACTTCACCCAAAGTTCCTGTGAGCTTGGGTGTGAAGTTCTTCAT
TTTTAGTCGTATCGAACGCTGTTTAGTCCTTGATTTGTACTCGAGATATGATCTCATCCTTGGTATGGCTTGACTTGAGCGCCATGAGCCATAGATCGAC
TGGAGGTTGAAAACATTAGGCGCAATACGCGCTGCCCTTAGCGGAGCTTTGGAGAGTCATTAACCCACCTCCGCTAGGAATCAGAAGTGCTACTGTCACG
AGCCACTGTCTGAAAATGTCCGTGTTCTGGACAGCGGAGGTGGGTTAATGACTCTAATTAGTTGTTTCTGAAGATGTCAAAGATATGAGCATGAAGCAAA
TCTCGATATGTGATATTGAAACGGCACGTACTCCGTTGAGTGATATTCGTTGTAAGAACAACATACTGAATGCTGAAAGCATTGTTGACCAAGCGTCAAG
CCATCGAGGGTTGAACCCAGCATATGAGCGTATAAAAATGGCACGTATGTACCCACTGAGTGACGTTGGCTGTGATAGCGACGCGCTGAATTTCAATGTT
GACATTTTTGGTGAAATGCCAAGGCACCCCGATCCCGGCTCAGCGGATGCGCGTGAAGTGGCACGGAATCTACGTGATGACGACGTCAAGTCAAATGACT
TTTCACCCGGTGTTGATAGTGACATCAGCTCTACCTTAGAGAAAATTACGTTTGACAATGATATCGATCAGAAAGATACGAATCATATAGCGCGTGCTGT
GTCACAAAGTGATGACAACTATCAGCTGTATACACTCGTCAACGGAGTGACTGGTGTCTATGATGGTACGGCTAGCCTTGAGGCTATAACCTCGTAAGGC
ACTCTGCTAGATCTTGACGAGCTGTCAGTAGATGAGTTCAGTCGTGCACTAAAGAATGGAGACATTTCAGAGGTGGTGGTCATTCGACCCGACATCATTG
AGTAGAACTCATCTTCGCTTCTGACGAAGGTGACCTGGAGGACACAAAAGTGGCAGTCAGTGCGCGTAGTGGGTCATGAATATTTAAAGATTCTCATGAT
CCCTTTTATTCCTTAGTCAAGGAATTTAAATATGTGGTGTGCCACGACCCACCCTCTTTTCTACCTCCAGATAGAGGTGTCCGTCATGAAATTAACTTAG
TTCCTGCGATTAAATACTGTGTCACACGACAGTGACCCTTGTCTAAAGAGAATGTGATGTCATTGATGAATTCTTCCGTGCCAAGCACGAGGCAGGGATG
GTACGTGAGAGTAAAACCATCCACATTCGATACCGACATTATGTATCGAAAAACCGAACGGCAAGTGGTGTATTGTGCATGCTTATAACAACCTTAATGT
GGTTACTATTGCGGCACAGACAACCAATTATTGGAAGGATGTTCTTCAAAACAACATGGTTAGTTGTACTTTATATAGTGCACTCGATTAGTCGATGGAT
ATTACCAATTTCTCATGCGAGCGAGTGATATCCCGCTTACAGCAGTGATCGTTCCGAGTGGTATGCTATGGGAATGGCTGGCGATGCCCCAAGGGATATC
TAATGCTCCGGATGGAATTAATCGTCTGGTGACACAACTTTTCCGCCCCCATCTAATTATGCAGATATGTACTTTAATGACAATTCTGTATATAGTAGTG
CCGAACAATGTCGGTCAGATGTTGACAATCAAATGGGTTATCTGCGAGCCGAGCTCGAGTGTATGTGTCTAAATAGATTGTACGTCAATGCGTCTGAATG
TATTTTTGGTGTAGAGGAAATTTCGTTTCTATGAAATTATATTGGCAAGCACGACCTCAGGGCGGATCCCGCTAGGGCCAAGGCTATAGTGGATTGGACG
ATATCTAAGATCAAAATGACTTGCGTAAGTGGCTTGGCCTTGCCAATCACTAACACACATACAGCGAAAACTAAGCTGATATGGCTTGGCCATTAACTTA
TCTCCTTAAGAAGGACATAGATTGGCTCTGGGACAACACCCATGGTGACGCATTTTGGTCAATCAAGGAGAGTCTTCTCTATGCTCCCATTCTGGCGTTG
CCAAATCCTGAGTGCCCTTATGTTGTTGTCTGCAATGCATCCGACTTTGCCATCGTCAGCGCCCTGTTACAAACAGATGATGCAGGCCGTGAGCGAGTTA
TCACATTTAATTCTCGTCAGATGAGAGCTGATGAAAAGAACTATCCAGTTCATGGAAAAGATCTACTTGCTATGAAGTATGCGCTCGTCAAATTCATCTG
CTTGGCTCCGACCCATTTGTCATCTACACGGATCATGCATCATTGCGCATGGCGACACAGTCGCCTCACCTCTCTCTTAGAATGACTCGTTAGCTTTTTT
TCGTTGCGGAATATAACTTCGACGTGAAATATAAGCCAGGTAAACAAAATCTGCCGGCAGATCCCCTCTCTCGCTGACCTGATTACGAGCTTGCTCATGT
CA