Description :
From Genome Similarity Track
Location :
Scaffold_102:4040- 9545
Sequence
5505 bases(100 bases per row)
ACCCGCTTGTTTTTTCGCACTTGTAATAGATGCACGGGTCGAGACTTGACTTGATAAAACCAAGTGCGATGATGTAATCGTTCATCGTCTCATTTCAGCA
GCGACCCGACTATTTGAGTCCACACAATGGCTTAAGCAGCTTGAGTACCTTGCCCTTCTCGACGTCCAGATCTCTTGGTGCCTTCATGCAGATGGGTTTG
CGTAGCAAACCCTTCACGTAGGTATTTGAAACGTCGCCGTGAGTCAGTCGCAGTCCAAGCAAGCTTGATAGTACAAAAATTAGACGCACTCTGATCGTTT
TGATCACTGTTGCAAATCTTTCCGAGAATTCAACACCGTGCTTCTGGTTAAACCCTCGAGCAACAAGTCTTGCTCTAAAGCGCTCATCGTCGCCATCAGC
ATCAAACTAGATCTTCAAATCCATTTGCTTTCGACGATGTTTGTACCTTTGATTGGTTCGTCGACAACCCCCAAGTGTCATTTTCGACGAGTGCATCGAG
CTCTGCCTTTATCGCATCGATCCAATTCTGGCTTTCCGGAAGAGTCATGTCTTCTCGAACGGATCTTGGCTCTTCACTCGTACAATGACCATTGAGGCAC
CGTCAGCATGTCGAGCAGGCAGGGTGACATGAAGACGCTCACATCGTTCTGCCAGCTATTGATTTACACCATTCCCCAACCCCAGATAACTCGCAATCAG
AAACGCTTGAGACATCTTCACTTAGACTCGGTATGCTATCTGCGTTAGAGATATTGTGGGTAGGTACATCATCTACAGCACTTAAATCCTAGTCGATACC
CTTCTTGGTTGAGTTAATTGACCGGACATGCTGAGATACTAAGATCTTCTTCGTGTGTTTGATGAACACGCGATGGCCCTTCACCTTATCATCAGATCCG
ATGAATATGCCGTGCTCACACTTCTTTCGAGTACCCATGGACTTATTCTTGACATGAACCGAGGCCCTTTGTCCCCACTTTACTAAGGTTGGGCTTGTGT
CTAGTGATTGCTTCGATAGACAACTTGTTACCGCCATTTGCACGTATCGGTAGGCGGTTTCTTAACCATGACTGATGTCGTAGTGCTTCGGACCATAGGA
AGCGGGAAGCCTTGTCAGCATCAATCATCATATCCCGCATACCAACAAATAAAGTATTGTGGCGCCTCTCCACCTTTCAATTTGAAAACGATTAGTCTGG
TTCCGTTAGTTGCTGTCGGATAGCGCGTTTTGAACACCACGACCTTATCTTGTTCGTGTCAAATTCATTGTCGCTACGGATGACCTTCACTCGCACGTCA
TATTGTCGCTCGAATCTTGTAATGAATTCTGTCAGTAACGGGAACCAGTCGGACTTAGCACGCATTGGAAAGAGTCTCCATAGCTAGACGCATAGTCGAC
GACATGCAAAGAGTGATTGCAGCCTCTGAAATCATGTGGCTTGATGTGTGTCTTGATATTAACTCCAATTACGGCGCCAATCTCGTCCATTGGTGATGAT
TCGGAAGTATATGTTTGCGCTTTAACGAATCACAGTCACTTCACTCCTTTTCAGTGATCATTAGACCATCAGCAAGGTCATGATTCTAGATCATCGCTAC
ATCCATCAGCAAGGTCATGATTCTGGATCATCGCTACATCCTCAACTTTGGTATAGCCAAGTCGAGCATGCCATTCCATGATGCTGTCATTAGGTTTCGC
TGCGACACTGGGAAACAGCTGATACGATTACCTGACCATTGAGGTAGCAAAGCCCATTGTCCCACGTCGCACAGCCAACAATAAATTTGACTCCCTTGTC
GTCAAGCTTCCACAGTGATGCACCTTGTTCATTAAATGAGGTATGGATACCTTTCTATGCAAGTTGATCAATCGATAGCAGCGTTTTGCGCAGCCCTGTA
ATAACGTGCACGTCTTGCAACAGAATCTTGGTATGCTTTCCTTTGACATTTATCTTTATCATGATATGTCCACACGTGAAAGATTGGATGGAGCGACCAT
CTGCGATAGTCACGGACAGATTGCATGCGTACTCGTTTTGCAACGCAAATCCGGTACCGCATATGTGGTGACTAGCGTCTGAGTCTAGAAACCATTCCCG
TTCATCCCTGGTGCCTCTGAATGCTGCCCAGCATGATGCGTAATAACAGTCCTTATCGTCAGTCTTTGAGGTCTCGAGAGATGTCCCCACCACATGAGCT
GATCCTGTTGACCTTTCTTCTTCTCCAAAATCTCCTTCTTGAGTGGGCATGTTGTAGCAATGTGACCCTCGTCTTCACAGAAGAAACAGGCACGCTTACG
ATACTTCTTCGCTCCTTCTGCGCTGAACGCATCACAGATTCATGCCTTGATTTCCGCCGTTTCTTCCTAAACTTTGGTTTGTCTTTCGTAGCACGCTCGT
ACAGATTCGTCACCTCCTTTGGCTTACATCCGAATCCCTTTCCGTTTCCTGTGGTGGATGTCAGCTATCGCGTAGCTTTCTCGAGATCGATCCCGTACTC
CATGCTATCTTGATCAATCTTCGCCTGGCAGCTTCTCTGATGTGATGGGAAAGGTATGAGCAGCAGAACGGTAGTGGTTCTAAGATGAAGTGCTTCGGGT
GTTACTAAGCCGGTCATATGAAGTGGGACAACCCGGTCCAGATGCGGTAGCGGTAACGACGCAGTGCTAATAGTGGTCGTGGAAAGCATGATAAGATGAC
TGGTCGACAGTTGTGCTACGTCGCACATGACCACTCACCGTTTCGACCTATTCGACCACGAGACACTGAGCGCTGGATTTAAATAACAACCACCGACGGA
TAGAAAGTTATAATTCATGGAAGAGGAACAGTCCATCTAACTGGTAGTGTAAATTAATGCATAATGCTGATTTACGTATTATACATCCCAGGACTCGACA
GGCGCCTTCTTTCGGTTAAACGACACGCGGAACGCGGTTTGAGAGTAGCGCTCAAGTTTTCCTCGTGTGTGATTTTGGGTGATCGCTGCGCATTTTATGT
GAAAGTAATGGTGGGAAAAGATTTCCTGCTAGAGTTTTAGCAAGAAGAAGCACAATTCGAGCATTAAACTGGGGGAGAAAGCGAGTATAACCTGTAGCAC
ATCCGGATGGGATACGTAAGCAAGGACGTACTGATAAAAAAAGACACAGCATCTTACGATTGGTATGGCGATGGTGAAGCAAGTTCTTAAGACATTTAGG
CGAAGGCTGTATGAACGGCAACTATATCGTGACGGCGTTTCCCTGGTGAACGTAGACGAAGATGTAACGTGCACTGAAACTAGCTCATAAGGACGTGATG
GGCCCAATGTGTAAGCTCTCAAAGGGTGGCAAATTTGTAAAGGTGCTGTCACTCATGAGCGAATACTGCCGGTATGTACTAGCGTACTTTATAAAGAACA
AAAGCTAGGTGACCGACAAGATTAAAGTGTTTCAAGCCTCATGAAAACCAATCGGCTGAACGCGAAATTTTCTGCGTTATGACAATGGATTAGAGCTTAC
GAGCAATACGGTATCTGAAATGTGTCGCCGGAGCGATATTATGCAACGAAGAACTATTCTGTACAGCTCTCAGCAGACTGGAGTGGAGGAACGATTGAAT
CACATGATCATAGGGAAGGCACGGACATGTTACACTACAAGGTTGTACCGACTATATTGTGGGCAAAAGCTGTGGTAAATAATGACATCTGTAATATGTT
TAACCACACAGCACATGAAGACTCGACATTGTACGAGTTGGGGTTCAAGGTGAAACCCCGAAGGGAATACTTATTCGTGTTTGGGTCGAAAAAGTATGCT
TATATCGATGATGCAAAGCGGACGAAGCTCGAGTCCAAACGTATTCGCCGTATGTAATAGAATACGCTGAGAACGCAAAGAGGTACCGTCTTTTGGACAT
GTATGCTTTTAAGGTAAAGCTGTCTTGTGCTGGAAATCCGGACAAGCGTGAGGTGGGCACTATGTATGACATGTAGTGGACACAGCTTGGAACGGTGGTT
CAAGTGGCCAATTAATATGTTGCTGAAGGTGTTCCCTTGCCTGAGGAGAGCCGGATGATAATGAACGAGCCTATAAAAATCTGTTGAAGATCCACTGTTG
GAAGTGAAAATGTAAGAGGTGGACCCTAAACAAGGACCCAGACAACCCCCTACTGCCTCCACCCGAATCGACGTTAGCTAGACCAGAGTAGAACATGTAA
CATCCGCCAACACAAGCGTCCCATAACGATCACTTTTCGTGTTCCACCACAAGATGATGGGATTGAGACGTGCCATGAATCTACGTTTCTACTAAAAGAT
AGTTCGGCCAATGATAACGAGCAGCAGTCCGTGATAGACTCCCACTACCGAAGCGTGCCTAACTAGAATTAGCGAATTATGCTTTCTCGCCGAGGCAGAA
TTAGGATATGCTGAGAGCATTGATGGCATCCCGCACACGCAAAACACATATATATATACGCTAAAGTTAGTAGAGAAGCAGATAAACGGAGTCAGGTCAA
CGTTTTAAAGCTTTTGAGTATCACCAGGAACTAGACGTGGATTCTACTTACACGGAACCAACACCCGTCAATTGTTGGAAAGTGGACTGGTATATTGGTA
TGCATGGACTTTGCATTTGGAGGAAAGAACGCCATGGGCATGATGTGCAAGCTGTAAAATGCAATCTACTGTTTTATGCAGGCATTGAGTGCTTTGAAAA
GAATAACATACTATGTGGCTCTGAAAAATATTTCAAAGACCTGTGGTGCGGACCAGTATGTCTACGTAAAGCGTGATCGGAACAATTTAGTGCACGTGTG
CCTGTATGCAGATGACATGATCATCGATGCGAAGACGAAAGTGTACATTCTTGAAGTCAAGCTGGCTATTATATGCCTTCAATATTAAGGAGCCGATCAC
AGAGAAGTTTATCGTGGGTGGTGTTTGACCACGAAACGGGTGCAGAAACTCTCATGATAAAAAAGTCGATACATCGATGATGTTTTAGAACGCTTCAGCT
AGAACAAGTCAAAGACTTTCGAAAATCCATACGATTCTTACATTAATCTATTAAAGTTGCTGTCACCAAGCACATAGGAGAAACATGCTGAAGAGAGGTC
AAGACCTTACCGTTCTTTGATCGGGTTTCTATTATAAATAGACCGGATATTGCTCGTATGGTAACGAAAGTTCCAAGCTTCCTAAGAAACCTTGGAGAGC
AGCACCTAAAGGCGGAATATTTGCGTTCTACGATACCTGGAGTGACTCGAGCACAGCATTATGCACCACGGAGGTTTCGGGACGGTTACTAACGAGAGTT
CACAGACGCTGAATATTACAGTAACACTGATGACCTACGCTCCGTCTTTGAAGTTATGGTGACCATTGATAAGGCTCCAGCGATGTTTAATTCCAACTAT
CATACTACAGTTGCTCTCATCTCTGCGGACTAAATGCATGATATGAGCATTTGCACGTAAGATATCATTTGGGGGTGTGCTATTCATGAATCGCGAGCAG
GCGGG