Description :
From Genome Similarity Track
Location :
Scaffold_170:404- 4830
Transcript NameFunction/comments
Hyaar_Emoy2811798hypothetical protein

Sequence
4426 bases(100 bases per row)
GATTGGATCGCTAGAGCTGACTGATATGATGGCCCATATCAGCCAATATGTGAGTGCTTCTGAATATTACCCCTTATGGTAATATTCACGAACATTATCA
ACCTCCATGATAATATTCTAATCAACAAGAATTGAGTGTTGATTATGATGTAACAGGCTCACCCCGTTACACTACCCCAATCGATGATGATGGAAGATCA
ACATGACATAACAAGATACGTTGGCGTACGACGCCTAAAGTCGTAGCCTCAGCTAGTTGCAGACCTAACCTCGTCGGAAGAGATTGTGAAAAATACCGAA
AATTGGATGATATTTGATATGACAAGCATAAACGAAGCGACAGTCTGCTTCCATAAAATCAACCTAATTACCAGTCGCACATTTGTGCAAAGGTCCCAAA
ACCATTACTTTACTCAACACAAGTAGGTGATTCAGATTGTCTATTTCCATGTTTTTACTATTTCCAAGATCTCTGGTATATATTAAGCCATGCCGATTCT
TTCGACACATCCCGTAGACTGTCGTGTGCTGTCGCCGATTCGACAGCACCGAATGTGGGGATGGACCCTATCAGCTGCTTGCGCGGCCTCCCGACGCGGA
GTGCGGTCACCGAAGTACCCGCGAGTCGCGGGGGACACCACCCGCCGTTATACCTTCCCCTTGCCTGCCTACTCACGACCTGCAGGCGCGCAAGAGGCAT
GCCCAAGTCGTGACCTCTCCCTTTTCGGCTTCCGCAAGGAATGATTACCGCCAAAAGAGGCTTCTTTCATCAAAAGACGGAGGTTTGAACTGACGTGACT
GCGGATACTTGGTAAAGGCTCAACACAAGTATAAATTCGATAAATAAATAATGTCACCCCATTATACCCAACTGCAACATGGGATAAGAAACTGCGTGAT
TGCTAACGAGTCTTTCTATCTAATAGACAACTGTCACTCGAATGGGGTTGCGCACGCTCCGGGCAGGTCTAAACATCCTCCTTATATAGACTACCTCTCC
TCTCTCGTACCCTCCAGTACACAACTGTACATAAATTGCTTTTGGGTCGTTCTATGTGATACCAATCATCGTCCAGATACAAAAAAAACATTTTGCCTGC
GTGAGGGCAATCTTCATGCGTCATCATACACAATTAATGATAGAGTTGAGCGTTACGATCGTGCGAGCGCTCGGTCAACCGATCGGTCTCGTATAGATAA
TCGCACGGGTCCCTAAGCAGATACTTCGTGTGCCCGTAGTTCTAGTGTCGCATTATTCCTCCTTTCTAGTGCAGCAACAGTCTCCCACATTTGCGATATA
AAGCGCCTTTTTGACATGTTCGTTGAATTTCTTGTGGCGTGTTAGTTGGATGGATGTCTTATGACCTGTTAGTTAGATGTCTGACCTGACTGTTGACTGA
GTGATGGCAGGAGATGAACCCTTAGGTTAGCACGGTAGGCCTTAACGCAAAGATATATTTATTCTCTTTTTAACCACCTTCTCCAAGGCCTCCTAACAAG
ACCTCTAGAGCCGATAGCACCTCTGCGAGCCAAGGGTGTGTCATTTTGGTTAAGCAAGTCTGAATCGGAAAGAGGAATTCAAGTTGGGACGTTAAGATGA
CAAAGAATATGTCACCTACTCCGTGGTGCTAACGGCAGCGCAAGATGGAGTGCCAGCCGACACCATGCAAATAAAGATGCGCAAGTTCAAAGGCGGGAGT
CCCAGGGACTTTCTGAAGTGGAGCAGCGACTTCCAGAGTCTCTCAAAGAAAAAGGGCTGGACTGACGACCAGAAGAGCCGGCATGTACTCGCGCTGATAG
AAGGGGACCTCGCATACGAAGTGGAGCTCTTAGTGGATCAAGCCAGAGCAGAAACATGGTCATTTGACCAGTTCTACGCAGCAGTGGGACTACTCTCCGT
GCCAGAAGATTTTAGTGAAGATTTGGACCACGAACTATAGCAAATGACGAAGCGATGGGATGAAAGCGTGCAAAAGTTTTCTCAACGTCTACGTGAAAAA
TACTCGAATTTTTGATTAGCTGCCCCAGAATGCCATAATTATCCCCGACGTACAAATGAGCTGGTAATTCAAGCGAGGAATGCCGATGTCATGGCAAGAC
AAGCTGGCGGCGGCTGGTGTTACTACCGATACGTATAATGAGATGGTGCTTTACTTTTCCCGACTTGAGAAGCAAGAACGACTGACAAAGCTACGATCAC
CGTGTTCCAGTACTGCCAGTACCTCTGTCGCACCTCGACATGAGAAAGTCGTGAATTCCATGCTAGGACCGACAAGTATCAAGTGCGCCACTAGCAGAAA
AATAATCGCAAGGGAGGTTATCAGGGAAAAAACAACAGCAAAACCAAGTTAGGAGGAAAGGTTGGGCCAAAGACTGAGGAGAACGAGACGTGGTGTTCGT
ACCACAAAACAAGATCACATAATACCGGCGACTGCTTCACTCTCAAGAAGAAGAAATAGGAACACAAGAAGATGGAGGTCAAGGCTGACCAAAATCAAGA
CAAGTACCCAACGATCTTCAAAGAGGAAGTTATATTCAGTGAAGATGAGTGTAAGGAGGAAGGGTCAAGCAGCGAAGACGAATATAAGCTGATTGGACTT
CTTCAACGGGCGCCGGAAGATCACTCAGCACCACTCCGCATAATTGTGCAGCTCCGGCGTGACAAAAAAAACAATTTGACGCTTTGCTGGACACTGGTGC
CCCAAAATGTATCGTCAATCAGTCTTTTGTGGAAACCAGAGCCAAACACGGCTACTGTGTCGAACCAAGCACGAGTACGTGCCAAGAAGTGTCCAGCAGT
GGAACTCCAGTGGCCCAGTTTCATTTTGTGAAGCTGGAAACCGTCTCTATTATTACTCACCGCTTCCAATTCATTGAAGATAGCAAGGATACGATGGTAA
TCGGACGGTATTTGCTGCAAACGCTTGGTCTGATCATTAAATTTTAAGAGCAAACGGTACAGTGGGACAAACAGTGTCTCAAGATTTGTACCGGGAAACA
CGTCAAGGCGACTTATCCAGTGACGGGGTGTGCTGAAGAAGAGATTAAAGAGCTGGCAGATTCGGCTGCCGAACCAAAGGACTTGCTCCCAGACCAGCTA
TCTCCTGAGGTATCGAGGCTTTACCTGGACCTCATCGCACAATATCGACATTTGTATGATGGCTATTTGGGAAGGATGCGGCTGGACGATTATTTGCTTC
CACTATCGCCGGAATATAAACCCGTTCATGCAAAACCGTATCCCATTCCGCGGAGCCTCGAGAACGCAGCACGGGCCGAAATCCATCGCCAGATCCAACT
TGACGTTTTAGAACAAATCTACGATTCTGAGATGGCTTCTCCAGCATTTTTCGTGAAAAATCCTAATGGATCACTGCGATTACTAATTGATTATCGTGTG
CTGAATCGTTGGCTCCGACGCAGTCCATGATTCGCTCCTCGAATCCGTGAGATACTGCTACGACTTGAAACGTGCGGTATATGACGACACTGGATGCCAA
CATGGGATATTACGCAAGACGATTGGCGAAGAAAAGTCGACCGCTGACTGCCTTCTGCTTACCGTTTGGGAAGTTTCAGTACAATCGTCTTCCCATGTGT
ATCTCAACAGCGCCGGACGAATATCAAGCCTGCATGGAAAAAATTCTTGGTGACCTTGAATTCGTTATCGTCTATCTGGACGACCTGCTGGTATGTTTAC
GCAGCATACATGACCACCTTGAGCATCTTAGAGTGGTGTTTGAGCGTCTGGACAAATATCATATCACTCTGAATGGTAAAAAGGCCATATACAACGACAA
GAAGTAGATTATCTGGGCTATACACTGACCGCGGAAGGAATCAAGCCCCAAGCGAAGAAGATTCAAGCGATCCAACAGATTGCGATTCCGCGCAACAAAA
AAGAGCTTTGACGGTTTTTGGGCATGATAAATTATTATCGTGATATGGTGCCCAACAAAACCGCTTTGTGTCAGTCCTTGCATCGGTTGACCAGTGCAAA
GATTCCCTTCACATGGCTGTCCAGTGATACGGACGCGTTTCGGGCAATACAACGGGCTTTTTCAGAGGCTGTGTTGCTCTCCTTTCCAGACTTTGACAGA
CCATTTCAACTCTATGCAGACGCAAGTGGGACACAACTAGGCGGAATAATCATGCAAGAATTGACGATCATCGAATGTTACTCTCGTGCCTTAACCAAAC
ACCTGACCAACTATACTACGATGGAGTTGGAATTGCTTTCAATAGTCGAAACACTTCGTGAGTACCGCACAATGCTTCTTGGATTTCCTGTTGTGATTCA
TACGGATCACAAAAAATTGATTTACCCCACGGAGACGAATATGCGAGCCAAGCGTTGGAAACTGCTTCTGTCCGAGTACCAGCTCACACTGCACTACATT
AAGGGGAAAAAGAACATTGGAGAAGA