Description :
From Genome Similarity Track
Location :
Scaffold_1957:404- 4370
Transcript NameFunction/comments
Phyag_g11802cytosol aminopeptidase, putative
Phyag_g11803hypothetical protein PHYSODRAFT_532549

Sequence
3966 bases(100 bases per row)
ATGCTAcgtcgcttcttcagctcgtcgccGGCTTCCGCTGCGCACCGCATGGTGCAGCAACGTGTACAGACTCAACTGTCTTTACTATCGGAAGCTTCTG
CGTCTCCTGCTACGCGCGTGGTGTTCGTGTCTCGCTCTGCATCCTCCGCTGACCTCCAAAACTCTTTGCCCTTCCccgtctccgccgccgctctGCGCGA
CTTCAAGGCCTCACCGCAGGAGAAAATGTACCTGTACCCGagtgtggacgacgctgcatTCAACGACCAGCGCGTGCTATTGGTGGGTCTGGGAGACGTC
GAGAAGGTGACGCCCAATGTGCTGCGAGACGCGACGCACGGCGCGTTGAGTGCATTGAAGGCCAAGCGAGCCAAGAGCGTCGTGGTGCAGGTGCCCGCTC
TAAACGGCAGCAAATTGGATGCCGGTCGAGTGGTGGAGTTGGTGTCGCAGGCCTCGATGCTGTCCAACTATCAGTTCGACCAGCACTTAACGGACGTTAA
GAACGCTGATGGAGAGAGCAAACtcaagctgccgctggaggAAATTTATCTTGATGGTTCGGCTGAGTTTCAGAAGGTGAGAGAGAGAGATTGGGCTTCT
GGGGAGATATGATAATTGAGAGAGGCTAATGAGgactttttgttgttgttattgtaGAATGCGATGGAACAGGTGACGGTGGGCGAGGAGACGGTCTTCG
CACGTAACCTCGGTTAGTAGATTTTTTCTTGAGAGATGGAGTGGTGGGATTTTATTCTtaatgtttttttttttttcatgaTGGTGTGCAGGTAATGGAC
GCTCGCACATTGTGAACCCGGCGTtcatggaggaggtggcgcgtGCGTCGGCTGATCTTCCCAACATGTCggtgcgcgtgctgcagcaggaggatATGGA
GAAGGAAGGCATGAACATGTTCCTGAGTGTGGGTCAGGCTGGCGTGTGCCCTCCTCGTCTCGTTATCTTGGAGTACCGTGGCAACCccgactcggacgag
aagatcgcgtTGGTCGGTAAGGGCGTCACGTTCGACACGGGAGGTTTGAACCTCAAGCCGACGGGTTCTATTGAAGACATGCACACCGACATGTGcggct
ctgctgctgtatTGGGAGCTGTTCGTGCTTCTTCGCGTCAGGGTCTTAAGGTGAACATCGTCTGTGCTCTTGCTCTGGCTGAGAACGCGATCGGATCCAA
GGCCGTGAAGCCGCTGACGATTGTCAAGTCGCACAAGGGTATCACTGTGGAAAACAACAACACGGATGCTGAGGGCCGTCTCGTGCTTGGCGACGCCATG
TCGTACGTCCAGAAGGAGTacaagcccaagaaggtCATCGACGTGGCTACTCTAACTGGCGCATGCATGGTGGCTCTGGGTGAACACTGCGCTGGGTTAT
TCTCTAACTCGGATGACCTAGCtaagaagctgcaggagactGGAACGGAGTGCCATGAACGTTGCTGGCGTCTACCGATTCTCCCCGAGCACATTGCTGC
CCTGAAGGGCTCGCAATCGGACTCCCGTAGTACTGGTCGTGGTCGCTATGGCGGTGCTTCCACTGCGGCAGctttcctgcagcagttcgtctACGAAGGT
GTTGACTGGGCACACATTGACATCGCTGGACCGTCAAACTACAGCTCCGCGAAGTCGTACTTCCCTAAGGGTGCCACGGGATTCGGCGTCCAGCTGCTCT
ACACCTACCTGAAGGAGCACGAGCAGCGTTAGAGGCGCTTCAAGGGTTCGTAGCTTCTCATGCCCTACGGACTGATGTGCGTCATGTTTGTTGTTACTCA
ATAGAAATGGCAAATGTGCAAGGCGTGTTGATGGATCGGGTAACGACGGTCACTGCTCTGTATACAGGTTCCAAACGAATACGCAGCCGTCATCACCAAC
AGAGACAAGTTGTCGATCATCTGGGCTGAAGGCAAGACCACGGACATTACCGGAGTGCCCCACTCCGTCCATGATCAATTGGTTGCTGTTAAAGTCCCAG
AGTTTCACGACTCGGTCGTTCCCGCCAGTGGCAAACACCTCGAGGTTGTGCGCTACTGCGATGCACGtggcttcttcgtcgtgAGCTTTCTGAATCACGG
TCACTGGGGTGTCAATGCGCAGATCCCAGTACGATATTCGCTTTTCCTGGCCGGCACTCAGAACTAGACGCTGGTCGGCTGATAACGCTACAGTGTTGAT
TCCACCCATGCGCTGGATGTGACTGGAAATTCGGCGTTCGCTGCGCAGATCCCAACAGAGCAAACTGCGGTCGCGACTACAGGAGATGACATGCACATCA
TCTCGATAGAGCGCCAGACTCGTGACTGTCATCGAATGCTCCTTGAGATGCGAAACCAAGTCACGCTTGCGGATATCCCATACACGAACCTCACCGCCGA
CCCCTGCCGACACTATAAAGCGCTGGTTGTAGCTCAGAGCGAGGGCTGTAACCCCGCCAGTGTGGGCGTTGTCGATGGACCAAGCGAACTCGCCAGAATC
ACTGCTATGAGATCGGATGCATCCATCAGTCCAGCCTGAGAtcagcacgtccagcgaATATTGGAGACAAGTCGGCATGCCTGCATTGCCAACGATGCAA
CGCGTCGCCACAGTGTAGTCGGAGGCATCCCAGATGCGAATTGTGCAGTCTCGAGAGATAGTAGCGAATCGATCGGACGCCTCCGACGCATAAGCGATCT
GCACGACACCGTTTGAGTGGTTTTCGGACAGCAACCTAGCCTGAAGGCTGCGTTGTGAGGTGCCGAAAGCGAGGCGGACCGAGAAAATACTGCCAGCTTG
TGTACCAGCAACGGCCTCATTGTGTGCTGCGTTCAGGGCCAACCCGACAACACCACTGTCGAGTGGAACTTGGCAAGTATCCACAAAGTCATGGCCATAG
TGCAACACactgccgtcgccaccaccaacgagaAGACCGCCATCATAGTACACTATGGAGTTCACACCGCAGGAACACGCAGGCACAACCTTGAATAGCT
GCCGTGTCTTCACGCCAACAACACAAAAATCACCGCTGGAACTACCAGCCACAAGCGTCTCGCGATCAGGAGAAAACTGCACGCAGGTGTAGTCGCGAAC
GAGTGTCTGCTCGATCTTGTGCTGTATGAGTTCCCCCGTGACCGGATTCAGAACCCACACCTGCAGCAATCGATGCCCAGCAGTTGCAAATTGGTAATTG
CCAGTGTCGCGGCGTTTAACATCACGAGCCATTCCTCCGAATGCAACCGCGGTGACAATGTTCGACATCTTCTGGTGCGTTGCGCAAATATTACCCGTGA
GGACGTCCCAAACGTACAGACGTGGTCCGTCTTCCGGTACACCCACTGAGCAAAGCAGTCGCTCATCGTCCGAGAatgcaagagcagcaataCCTGCATC
GTGTTCCGATAGTCTGAAGGCTAGTCGCCGAGCTGCATAGTCCCACACCAACACGTCTGCACGTCTGCCACGCTCGCCCGAAGCTAGAATTCGCCCCGAA
GGAGACATCGCGATACATGATACATTACCCCCATGGCCACGCAGGAAAAGTTGACTATGCGCGTCTTGAAACGACGTTAGCAACACTGATCCACCCGCAG
GATACACGTAGTCTTGACCCGATGGATGGTAGTGAATGGCGTTCGGTACCGCTGAGAAGCCGATGGTGTGCTCCAATTCAATCGCGGTGGCCAACTGCGA
CTTCTTGTCGAAACGTTGATGCGGTTCATTGCAGGTTCCAGCGAGTCCTCTTGAATTCAACTTGCTATCCATCACAGAGGGTGCACCTTCGTAGCCGCGA
GAGTTATTGCCACCATCGTACTGCATTGCCGGAGCTTctggcgttcttgctgcaatcACCAATATGAAAGGGTCGTTGACAACGAGGAAAAAGTAACCAC
TAAAACTAAACATATATCCCTCTGTAGTTAGCGACAGCCTACGCCAGGGACCCGGACTTCAGAAGC