Description :
From Genome Similarity Track
Location :
Scaffold_3016:404- 1777
Transcript NameFunction/comments
Phypl_g15560hypothetical protein

Sequence
1373 bases(100 bases per row)
CGCAAGATGCtgggacaaggcgctggtcctTTTGGGAACCAGTCGCTACGTGTCACCAggtcgccaccttctctcAACTCAAAGATCCCGCCAACAGGAC
GCGACGAGCACGGAAAGGTCACCCCAAGGacacctccacgagctgaTCAAGGTACACCAAGACCCTGATCGACTCTACACAACGGCCGAGTAAAGATTTC
CACGCGGCTGTCACCAACAATTCCCCAAGTACCGTCCACACAAGCTCAACTCAAGATCGCGCCGACATTTTCGCAGTCACCGGAAAAGCGTAACCTGCCC
AAccaacgggtacacaagATGAGAAGATTTCAGCCACCACGGACGaacggagtaccccctccgtaaGTTGGCAGTTTGGGCAACAGTCGGCTAGCTTGGA
TCGCATCAGCAATTTCGCGTTTCCTCCTCCGCCACAATGGTGCGGGTGCCCGGATTTTCTGATGACTCTGGATTGCACCGTGAGTccgccgaagaagatg
tcAATATCAAGGTTAAGCCAGGGATTGGTGCGTCGACGGAAGGTGAaccgctgtcgtcgctgctgaaaaACGAAGGATACACCGATAGTTGGAGCCCTGG
GCGGAGTTCCGACAACGTAAAGGAGGAAGGTTCAGCGATGGacctcgaggagaagcctccatctcctcccCATGTCCCTTCGGGGACCCCCGCGGGTCGC
GCGAATGATGGAGATTCATCGGTGAAAACCGAGGGATCTCCATCTACCACCACTCCTCCGGCCTCGCGCCCGaccttgaagaagaagaccccGCGCATGA
AGCTGAGGGCCCCCGAGTCCGACGCGGAAGATCGCAGTGTGCTTGAGAGCTGGACCGACGATCAGTTTGAAGCACGCTTCTTCCGAAAGGGactgtacgc
gctgctgatcgaGGATCCAGTTTGGAAGATCATGCGGCTGAAGCTGATCGGTGATCTTTGAGGACCCGTAACCGCGCCCAGGGAAGTGCTGTACACGCTA
GACACGGTGAAATACCTGAAGCGCATTCTGGAGGAAGCTGCGATCGTGCCGAGAGCGTTCGACGCGAACTTGTGTTTGATCTGGAACTGACCGCGACCAC
GAAGGCGATGCTCGCTCTCTTCGAGAATGCTGGCTGCTCTGGTTGGAGTGGCCACGCTGGTTGCAACGATACTAACACCGCGCAGCGGTTCATCGCAGTA
CGCGTCAGCTACGTCGGATGCGGGGTCAGACAGTTCAATTGAGGAGAAGAGGATGACGCTGGGACCAGCTGGCGCCACCATGCTGGACGTTCGGTAGAAG
GAGGCGAAACTGGCCTTGCCACTGGCCGCGCCATTAACCTCCGGGACGTTAGCTACGGACCCGGACTCGCCAG