Description :
From Genome Similarity Track
Location :
Scaffold_3216:404- 1526
Transcript NameFunction/comments
Phypl_g15695hypothetical protein

Sequence
1122 bases(100 bases per row)
TGCTGTTCCTTCACGAATCGAGATTTCGCAGCGTTGAAGAACGTCTGCATGCGATCTGGCGAGTCCGGGTCCGTAGCTAACGTCCCGGAGGTTAATGGCG
CGGCCAGTGGCAAGGCCAGTTTCGCCTCCTTCTACCGAACGTCCAGCATGGTGGCGCCAGCTGGTCCCAGCGTCATCCTCTTCTCCTCAATTGAACTGTC
TGACCCCGCATCCGACGTAGCTGACGCGTACTGCGATGAACCGCTGCGCGGTGTTAGTATCGTTGCAACCAGCGTGGCCACTCCAACCAGAGCAGCCAGC
ATTCTCGAAGAGAGCGAGCATCGCCTTCGTGGTCGCGGTCAGTTCCAGATCAAACACAAGTTCGCGTCGAACGCTCTCGGCACGATCGCAGCTTCCTCCA
GAATGCGCTTCAGGTATTTCACCGTGTCTAGCGTGTACAGCACTTCCCTGGGCGCGGTTACGGGTCCTCGAAGATCACCGATCAGCTTCAGCCGCATGAT
CTTCNTGgggaggagatggaggcttctcctcgaggtCCATCGCTGAACCTTCCTCCTTTACGTTGTCGGAACTCCGCCCAGGGCTCCAACTATCGGTGTA
TCCTTCGTttttcagcagcgacgacagcggtTCACCTTCCGTCGACGCACCAATCCCTGGCTTAACCTTGATATTgacatcttcttcggcggACTCACGG
TGCAATCCAGAGTCATCAGAAAATCCGGGCACCCGCACCATTGTGGCGGAGGAGGAAACGCGAAATTGCTGATGCGATCCAAGCTAGCCGACTGTTGCCC
AAACTGCCAACttacggagggggtactccgttCGTCCGTGGTGGCTGAAATCTTCTCATcttgtgtacccgttggTTGGGCAGGTTACGCTTTTCCGGTG
ACTGCGAAAATGTCGGCGCGATCTTGAGTTGAGCTTGTGTGGACGGTACTTGGGGAATTGTTGGTGACAGCCGCGTGGAAATCTTTACTCGGCCGTTGTG
TAGAGTCGATCAGGGTCTTGGTGTACCTTGAtcagctcgtggaggtgtCCTTGGGGTGACCTTTCCGTGCTCGTCGCGTCCTGTTGGCGGGATCTTTGAG
TTgagagaaggtggcgaccTGG