Description :
From Genome Similarity Track
Location :
Scaffold_1095:404- 1522
Sequence
1118 bases(100 bases per row)
aatgggtacgcggtgacataattacccTTATCATAATCATGTGTGGAATGAAGATTCCTACACTTGGGAACAGCATCAGTGACGCACGTGTGGTGAAGCG
TACTTCAAAATGATCGACTGTGGTTGAAGagacaaggagatcaagaccGATCAACCTCAGGAagaaaaggtgaagaaatAATCACCTGATCCGGGATAGG
GTTGATCTGGATTCAGATCGATCCCGATCTGAGGCGAAATGGTCACAATCATTTCGGTACAGATCGCGATCCGATCGACCTCGATCAAGATCAAGTTGAT
CCAAACATTTGACGACCTGTACCACCTTTTTGGTACAGGGTGTCAACAAGATTCAGTGAAGATATGGAAGCAGGTGATGAGCGAAGAAGATAGCTGGAAA
AGGTCGAAGAAGAATCCTAAGATAAAACAGAGTCGAATTTACCTTCTAAGGCGCAAGTGGTTGAATACTGGGGCAGGAANAAGACCCCGCTATCGGAAGc
ggcaagaacaaggaaATGAAAGGAAAGGAGCGAGGGCCAAGCACACCCACAAATAACCAGGCTCCCAGGGCCCAGACACATTTTTGGCCCGCCTACCCCG
ATCTCGAATAATCGATCGCTGTAGGTAACCCACACGCtgctacctgaagaagtttccacgtAGCAGCACCCCAGTCCCGCGTCTCACCAAGACGGTTCAT
CTGGCTTCAGCGCGTCCTCTCGAGACATccagagagcagagctagcccaccgacgggtacacaaggtgagaagaattcagcatccccacggatGATCGGA
GTACCCgctccgttagtcggtagttcgggcgcaGTGTGTGAGCAGATCGCGAACGCGTTTTCGCTGACCTCGCTACACCACACCAGTATATTTTACGACA
AACACCCATCGGCTAGTAAGAATCTTCCGCCCGCTGGGACGGGGAACTAATACCCAAGTGTTATTTTCCATAAGGGATCTATATTCCGAATTGGCTGCTT
GGTGCCACTGATTAGTGTGAGAAGATTGCATTGCCTCTCAATACGTAGTGGGTTCTGACACATACCGAATAGCTAGTAGTATGTACAGTAACATCTTGCG
CTGTTCATGTTCCCGTAA