Description :
From Genome Similarity Track
Location :
Scaffold_227:4039- 5962
Sequence
1923 bases(100 bases per row)
ACATACACGCCCGAGAGTCTTTTCGGGGATGGAGCTGCCTCCTTTCTGGCTCGAAATCTTTCGATGCAATCATCCGCGCGTCATTTTCCCGCTCCTGCGT
ACCGACTCGACAGACAATTGAAGACCGTAAATGTGGCCATCACTTGAGCATTTTTGACAAGGAACATAGGGTACAGCTCGTACAGAGAAGTCCTGGTGCG
GGGCTCAACACACGATGATATTGGCCATTTTAAGAAGAGAAAGAGATACTTGACGCAACAGGACGAGCAGGTCCAAACAATTGGAGACCAGAAGACCAGA
AACACAATACAAACAACCCAGGGTGTCGAGCGCACGCCATTCCGCATTTGAGGGGTCGTAGCGTCATGGATAATCCACCTCGTCGACCACTGGGCAGGTA
GGACTTCCCTGCATTCGATACCCCCGATCTGCTCGGCCGTCTACGGGGAGACGCAATAGCAACGCCGTCGGTAGATGCTTGGCAGAATGCCAAGGCTGTG
ATGACCCTGCCTGCTTGTATGGAGCACGTCCGCTTTCAAGCCGGCAGCGTGCGACTCTAGGTGTGGTTGTGTCGACCATCGCGCTATCTTCTTGCAGCAA
CCTGGACACTTGCCAATGGCGGCCGACACGGCGATCCACGAGGCTGCTTGAGAGTGCACACGAGTCGAGCTAGAGAATCGTGAGAAGGACGGAAGGTCGT
GGTGACGGGCTCGCCAGCTTGGGGCATTCCCATACTAGTAGTGTCTGCTGCAAAATGAGCCTCCCCACCACAAGCAGCTAAGTAGACACCAACACGGCTC
GTGCTCTCAAGTACTTGTGTCTTGGGCTTGAGAGCGACGTTTTCTCACGAGATCCTGCCTTCGTATGTCTCGGACGACCGACTGCACACGGCGAACTCAA
AAGCAACACTACATTGGCTCAATTGAGAATATACTCTAACGAATGGCGGTCGCGCGTTGTCGTTTGCAGCAGCTTTCGCTGGTAGTAGAGTTCTCGGCGC
TTGGCGCGGATCTCGCTGCGCTGCTTTTCGTATTTGAGTTTGAGTTTGGCCAAGACGCGGTGTTTGTGGTGTTCATAATACACTTTGGATCGCCGCCGAC
TCATTTCGCGCTGCGCAATGGACGGTGGGCGCCGCTGGCGCTTCGTGCGCGGTGGTGACGGCGTAGTCGTCAACGATGGAGCATCCAAATCGGATTCCAT
CCAGGCGTTGGCCATGGGCATGGAGCGCGACTTGAGTGTTTTGTTTCCACTGGACGTCACGACGAGAGGCATCGCTGAAGATTTTGGTGCGGTCGGTTTG
ATTTCAGTTGCAATCGCCTTTGAAAAACGTGCGAGCCAACCCGAGTTCGCTTGCGCGAAACCTGTCGTCGTTGGTGCGACGCCGCTGGCGGAGGCAGAGA
TGGGCGCGCACAAAAAAGCCACGCCTCGTGGCGTCCAAGGAAACAACTCGTAGCCATACGTAGCCAAGCAAATTTTAGAAACCCGCTTTGGGATCGTGGA
GTAATGCTCTAGAGTAGCACGCGATGGCATCATGTCCGAGCCACATCACTGGGCACGGCCACTGCGACGGCACCCATTGGTGTTTGGTTTCCCTTCTAGC
TCGCCGCGTTTGTGGCGTGGGTTTGGAGGTTAGAAGGAGGTGGCCACGTGGTTTTTTCAATATAATCCATTTTCGATCAAGGACCAACGTGCCACGAAGG
CCTGAAGAGCAGGCGCATGCGATCGAGTTACAGGAATGGGCGTTAGAAGGACACGTTCTTCTGTCATACGCTCGACATGGGTGGCGACGACGTACTCAGA
ATACCGACTTGGCTACAGTATGGAAATACGGGCGTGAGAAGACTTCAAGGATTGGACCTGGGTTGAAAGTGGGCGTCGTAAGGTGAAGCGTGGGACTCGA
TGCCTGGGCTCGCACGTTATCGA