Description :
From Genome Similarity Track
Location :
Scaffold_994:4039- 5214
Transcript NameFunction/comments
g15327.t1POM68377.1 Hypothetical protein PHPALM_15469 [Phytophthora palmivora var. palmivora
g15328.t1hypothetical protein

Sequence
1175 bases(100 bases per row)
CGTCGCACAAGTTCGTCGACATCTGGATCTACTCCTTCCAAGAAGCTCAAGCGTTCCAAGCGTCGGAATGACCTGTCCGCTACTGACTTGGCCCGGAAGG
ATTTCGAGTCTCTGACGTCCTTGGAGAAGACGATCATCGAGACGCCTGGTCCGAGCATCACTTCTTGGATGCACTTGGGCATCCGGGTGAAAAGAGGTGA
TCCGACCACGCTCTCTGCCCTCCAGACGCCGGGCTTTCCAGACTACGCTCCGAACCGGTTTGACTTGGACCTCCTGAAAGAGCGTTGCGACGGGCAAGAA
CTGGGTGCCTTTCTGAACACCATGCCTTGGCGTAAGATGTTCGATGAACGTCCGCGTGAATTGTACTTCCACAAGCGCGAAGATCTGGATGACGAAGTGC
TAAATGCTCTTGACGACTGGATGGACTTCGTGTGTGGAAACTTCCGGGCGATCTGGGACATCCTGCATTGGCTCACGCTGGATCGCTCTTCAGATGCACC
GCCGGGTATTCTCAAGATTCAGACCAAGCGCGCTCGTCGTCATGAAGGGTTCCGAAAGAAGGCCTTGGCACTCCAGAAGAAGTTGTCCACCAAGTTGCCG
TCTACCATCTGGAACGAGCCTGGTGTTTGGAAGTTCCCGAACAAGATTTGCCACTGGATCCTGATGGACAAGCAGCACTTCAAACCAGGGACTTCCGAAT
GTTACTCGTTGCAGGAGCAGATGGAACTTCTGGACCGCCGTGAGCCTGCTCGCGCGCAATGGAGCTTCTGTTCCACGGATGCAGAGCGCATCGCCCACCT
TCCGGAAAACGTTCGTCGCGGTCTGATTCCTGCTGATGAGCGGGATCCAGTCACTGACATCTTCTCTTAGTCTTCCATTGGCAATCCATCCGGACGTCGT
CACACATCTGCACGTTTTTCTCTTCCAGTAGTCTCAAAGTTAATCGTCCGAAATATACTTACTTGACTTTCCAAATGTTCCCAATCACAACTTCCCACGG
TATCCACTTCTCGAAATTCGCCACTTACAATACACACTCGATACTCACTCCAATTTCACAGCAATATAATCACACATTCCCAAAGTCCGTTCGTCTGATC
CATCCAAAATGATGATATCTCGAAGGCCTAAACTCTTGGATGGTCATCACCTGCTTGCATAGTTTGGAAGCGAGC