Description :
From Genome Similarity Track
Location :
Scaffold_1133:4038- 5489
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_1133-snap-gene-0.3Phosphatidylinositol-4-phosphate binding protein

Sequence
1451 bases(100 bases per row)
TTCCCCCTGCCGGATGGCGCaCTTGACGAGGTTAAGTTGAGCCCCGAGCAGATTGAGCAGTTCGCCAAGCAGGTTCAGGAGCTGATCGCCAAGTCGCTCG
AAGAGTACGAGCAGGTCGAGACGCAAGGGCGACGCCTTTACAATGGCCAAGCATGGGAGGTCGTCGGCGAGTCGGATGGCATGCATGCATGGCGCCGTCG
CGAGCCAGGGTCGTCCACACGTGCCCACTACCGTCTCATGGGCCACGTCAACGCCGACTACCGTCACATGATGGAACTACAGTACGCAGAGAACGCAAAC
GATCTCTTTGAGTGGATGCAGTACCTGTACAATCACACTCTTGACGCCCACATCGTTCAGAACATTGAGACAGCGTCCATCGACAAGCCGCACCATTACT
TCGGTGTCAAGTGGGTTGTCCACCAGCTCAGCGTGTTCGCCAGCAAAATCGACCAGTGTTTTGTTGAATACATGACGTACCAGAAGGATTTACGCGGCCG
CGACATCGCCGTGCGCGTTATGGTGCCAGTGCCGTCCCCTCAGATTGATTTCGCCATGGACGCGATGAAGGTGCGGCGGCTCAGCTCCACAATGGTACAG
ATCATGCGCCCTGTGGCGGATGTCAAGCGCCCCATGACGCATCATTTCGTGCTCGCCGACAATGAATTCCCGTTCTTCGTGCCGAACAACTACACCAAGA
CGCTCATGATCATCGGTCAGAACATGCCGCTGTGTATCGACTCGAAGCGTATCATGCGCAAGGGACTCATGCACGAAAGCAGCTGGGTACCCAACTCATC
TCGCCGTGGCTGTGTGGTGTGCACACGCACATTTGGCGCAGCaCGTGGCCGCCATCACTGCCGActttGTGGTGAAGTCATCTGTCGCAAGTGCATGCTT
GTACGTGATACTCCCGACTACTCGTCTGACAAGGTCTTCAAGCCCGTCAagACCAAGTTCTGTGTGCTGTGCATCACTAAGCTGCGTGAGCCAGACGCGA
CCCAAGATCTCAGTGCTTCCCGTATCGTTGAGTCGAGCAAAGTTCGTGAGATCGAGTTCGCCCCATTGGAGATGGACGAGCAGTCGCGCGTGTCCGTGTG
GTCCGAGACCGAGTCCGAGGACTGCCGCACTGACTCGGAGTTTGGCGATGTTACGAGCGCCCGGTCGTCGCTATCGTCAGTGTCcGAGCAGGGCAGCGAC
AAGCATtCGTTCAcATCTcGACTTCAGGATATCGCCGAGCGGATTGAGGacActGTGATCGAGgAGGTGGGAGCTGATGTCATCGCCACAATCGACACCA
AGGACATGCTGCGGCAGCCGCACGGTCAGCCGGGAGGgCTCGAGCCGCCGTACGACTTTGTGTACTCCCCCGAGCGGCGGCGAAGCTCAAACCCACGGTC
ACTGGACCAGTGCCTTGCTGAGCAGGAAGCCCTGCTACGGCAGATGGTGCT