Description :
From Genome Similarity Track
Location :
contig_20:40376- 41927
Transcript NameFunction/comments
g4178.t1hypothetical protein

Sequence
1551 bases(100 bases per row)
CATTCGCGGATGGGGTGATTCCCGTGGGTGATTTCTGCTTGGGTTTGATGGACCCATACACCGTCTTTCCTTGTCTCGCCTTCGCACGTTGTCGGGATCG
CAGTGTCTCTTCGAGAGTGTCTGCGTCCGGAATTCTTAGCAGTGCCAGTTGGCTGGCTAGATCGCGATCGTCGAGTGTTTCGATGAAGTGATCGACATGT
TCACGGCGGACCTCAATCGATCCATCCTTGATCGAGAGCTGAGCTCGCAAACCAGCGACATTCAGACGGTGCAGATATTCCAGCGGCGATTCATCCGATC
GCTTTCGCGCATGGTAGTATTGTCTCGCGACAGACACGCCACGTCCGCAGTATTGAGTCTGGAAGTTCTTAGACAAGCTCTTCCAGTTGCCGCGCGCGTC
CGACTCAGCTGTCGGTACCAGTTACGTGCGGGTCCAGTGAGCAGATCTACAAACACCAGACACTTCGCCATCAGGAGCTTGAACGCGGACAAAGACAGAC
TTCAGTTTGCCGAACCAGCTTCTGGCACGATCTTCGTCGTTATCCTTCCCCGAAAATTCCTTCAGTTCTGAGATCGCGGAGACTCGGATCCTTGTGGCTG
AGAGTGTTCCGCCGCCTGTAGTCCCAGCAGATGCGACTGCGGCACGAGGGGTAGCGTCGACACCCAGGTCATCCGGATCGTATTCGCTCGGGTGCGAATG
GTCCCGGCGATTCGACTCCACGGACTCCATGTCAACGTCTTGAGCTCCAGGTGGCTTGGTTTGGTCGACGACTGGCGTGGTCGAGACCGCTTGCTGTTCC
TTCAGGAAACGCTCCATTGCTGCATTGAAGAACGATTGCATGCGTTCAGGGGAGCTTGGGCTGGATCGCTCGTCGCGATAACTGTCGGCTTGGTTTCCGA
TCTCTCCTTTCGCGACTGTAGCATGGCTGCTCCGGCCGGCCCAAGTGTCATCCGCTGCAGCTCGATCGAGCTGTCCGATCCCGCTTCGGATGTGGCTGAG
GCATATTGCGACGATCCGGTTTGGCTGCGAGTCGGTGCTGGTCTTTCACGTTGAACCGGGACGACACTACCGACAAGGGGCGTCAGCTTCGCGAACAGGC
TCAGCGTTGATTCCTGATGATTGGCAATTCCAAGTCGAATAGCTCGTTCGCGTCGAAGGAGCCGAGCACGATTCCCGCTTCTTTCAGCATGCGCATCAGC
AGTTTCACTGCCTCGAGTTGGCTGGTTACTTCCTTCGGTGCCTTCACTGGACCTTGCAGTTCCCCGATTGGCTTCGGGCGCACGATCTTCATTACAGGGT
CTTCGTGCAGGAACTTGTAAAGGTCCTTGTAGAAGAAGGCAGACTCCAGTTGCTCGTCCGTCCACGTGTTGCAATCCTCCTGGTCTTCGGCTTCAGACTC
CGGTGCCTTCAGCTTCTTGCGTGAGGTCTTCGACTTCTTCTTCTCTCGAGGTTGCGTGCGGAACTGGAGGAGTGGTTTTGGATGAAGGTCCTTCGGTTTT
CACCGTCGGACCTTCGTCCGGCGGATCACGATTCGCATCGCGATCCGCGGG