Description :
From Genome Similarity Track
Location :
contig_44:403741- 407587
Transcript NameFunction/comments
g9396.t1hypothetical protein

Sequence
3846 bases(100 bases per row)
ATTCATGGCAAGTTCGCCTGAAAAAGGTGGCTCCAGTGAAGTGCCGTTCGCCCAACTGGTGACGCCACGCGCTGCTGCCCCCAATTTCGTTGAAATCGAC
AGGAAAACTTCACAATGCTTCAGTGACCAGCAGAAGTTAGCGTCCAAGTTTTCGTTCCTGGATCTGTACCGCTTCGCGACGCCATGGGACCGCGTGCTAA
CCATCACGGCCGTCCTCATGGCGGCAGTGAACGGCGCACTCTTCCCGTGCATTGCGTTGGTGTTCGGCAAAGCCATCGGCGCCTTCGCCCAAGTTGGCGG
GGGCGTGGATCGTGGTACCTTAAACAGTGCAGCTCTGGACTATTTTCTGATAGCCATCGGGCTGTTTGTGACGGACTATTTGGCGTATCTGCTGTTTTCA
CTATCGGCCGAGCGCCAGATGAAGGCTCTGCGTGCTCGAGCGCTGCAGCACATGCTGTACATGGATATTGCGTGGTACGACCTTCACGACCCACTGCAAT
TATCTACGAGAATCACGGGAGATACTGTCAAAATCAAGGACGGGATGGGGGAAAAGCTGGGCAACGGCATCAAGTATATATGCCAGTTCGTGACGGGCTA
CATCATTGGGCTTGCTCGCGGTTGGGATACTACGCTGGTGATGACGTGTGTCATTCCTGTTATGGGCTGGTCGATGGGATTTGTCATGAAAAAGTGGCAA
ACGAGAGCCACCTACGCACAGCAAGTGTACGCCCAAGCAGGAGCTGTGGCGGAAGAAACGCTGGGCGCCATCCGGACTGTAAGTTCTCTAACGGCTGAGC
AACGCGCGTTGGACAAGTACAACCAGCACACTGCCGAGGTCGAGAAAGGGAACATCCAACAGAGCAGAATGCTTGCGCTTATGATTGGCCTTTGCCGGGC
CTGTGACTGGCTCATGTATGCCGCTGGCTTGTGGTACGGAGGCTCCAAAGTGTGGAGAGGAGAAGCCTCGCCGAAAGCTGTGTTCCAGGCGTTGATGGGC
ATTCTCATGGGCATGAGCTCCATCGGACTCATTTTCCCAAATCTTACGGCTATCCTGGAAGCCAAAGGCGCCGCTGTCGCGCTCTATGGGCTGCTGGACA
CGCAATCTCACATTGATGCATCTCAGGCTGATGGAGTCGCTCCCGACTCGTGCTCGGGTCGGATTGAGGTTGTTAACGTCAGCTTTGCCTACCCAAGTCG
TCCGGACGCTCCCATTTTGAGAGACTACAGCGTCACCATTGAAAGCGGCCAGACGGTGGCGTTCGTGGGTGCGAGTGGTGGCGGGAAGAGCACCATTATC
TCGCTGCTGGAGAGGTTTTACGACCCGACAAGTGGGTCGATTCGGCTGGATGGGCGCGATATAAGGACACTCAGCGTGAAATGGCTCCGCTCTCAGATTG
GCCTGGTGTCGCAGGAGCCCGTGCTGTTTGCTACAACCATCGGAGAGAACATTGCTGCTGGTAGAGCTGACTTTACGCGCGAAGATGTCATCGCTGCGTC
GAAAATGGCCAACGCGCACTCATTCATCATGTCGTTACCCGAAAACTACGCCACTTTGGTGGGTGAGAAGGGTGTTTCGTTGTCTGGAGGCCAGAAGCAA
CGCGTAGCAATCGCTCGAGCTGTCATTCGCAAGCCCAAGATCTTGGTTCTCGATGAAGCGACGAGTGCGCTGGATGCTGAGAGCGAGCAGATCGTGCAGG
AGGCGCTGAACGAGCTCATGGCCAAGACAAGCATGACAACACTGGCCATAGCTCATCGGTTGAGTACGATTCGACACGCAGACAAGATCGTGGTGCTGGC
CGACGGCCATGTCGTCGAAGAAGGTCCTCACGACGAGCTGGTGGAATTGAGCACGGCGTGTACCGCAACTTGTACACGATCCAGGAGACAAAAGCCCAGG
AAGAAGCCTCTCTAGCTTTGTCGGACACAGAATCAGAGCAGCAGAGCGGTGGTTTGGCTGCGGCTTTGGCACGAAAAGCAAGCAATCGGTCCATGAGAAG
TGAGGAGGCAGATACAGCGGCCATGCTGACGCTGGTGGCGAGTCAAGAGATCCTGCTCCGCGAAAATTTACGTTGAGAGACGCCAACGCCCTGAGCCAGC
CAGAGCGTGGGTATTTTATCCTGGGTATGGTCGGAGCTGCAGTCAACGGTGCCTCGTTTCCAGCGTCCGCTGTTCTTATCAGTGAGCTGGTGTCGATTAT
GACGACCGACTACGCTTACTATCAAGAATACGACGATCGATCGTACCTATCTTCCTTGCCGCACAGAGTGACAGTGTACGGATGTCTGTATATTGCTGGA
GCTGCGGTTCTGTTCCTCGGCCGTGCTGCTCAGAGCTACGGGTTTCAGTATATGGCGGAGACACTGACGGCTCGCCTCCGAGGGATCACTTTTCGTCTCT
TTGCAGGCAAAACATTGGCTTCTTTGACAGGACGAGAACGCGACCGGAGCGCTGACGGCTGACCTAGCGACAGACGCTCTGCGCGTCGCAGTGATCTCTG
GCGAGACTGAAGGACGATTGTTCCAAGCGATTTTCACGACGGTCGCGGCGCTCTTGATCTCGTTTCTGGCTGGGAGCTGGCTTCTCTCGCTCGTGATGCT
TGCGATCATCCCATTCCTCGTGCTGGGAAACATGTTCCGAGGCAACAACATGCGCGGGAAAAGTATCCTAGCCGATGATATGGCGAGGTTGGCGCGCATG
CGTCTGAAGTGCTGGGCAACATCCGGACGGTGGTGTCGCTGGGTCTCGAAAGCTCGTCCTGCGATAAATTCTCGGTGCTACTAGATGCCCCCATGAAGAG
CGGTGAGCGAGACGCACAAGTGAATGGCCTGGCAGTGGGCTTCAGCTCCTTTATTGTCTTTGCGACGTACGCTTTCGCCTTTTGGTACGGCGGGAAACTG
GTGGATGACGGATCGATTTCCTTCTTGCAGCTGATGCGCTCGCTCATGGCGATCATCATGTCGTCCATTACAGTTGGAGGCTCCATCGGGTATCTCGCGG
ATACGGACAGCGCCTTTGAGGCTGGCGGGATCATCCTTTCGCTTCGAGACCGACCGCTACCCATCGACTCGTTCGGTGAGGAAGGTTTGCAGCCTCACAC
CGTCGAAGGGAGAATCGAATTCAAGGACGTACTCTTCCGGTATCCGACAAGACCAGCGGTGACAGTACTGAAGAACTACAACCTCATTATCGAGCCTGGA
GAGACTGTCGCGTTCTGTGGACCCAGTGGCGGCGGCAAAAGTACGTGCGTGGCGCTACTCGAGCGATTCTATGATCCTATCCACGGCCAGGTTCTGCTCG
ACGGAGTGGACTTGAAGCAGTTGAATGTGCGCTGGTTGCGGGGTCAACTTGGTCTCGTCGGACAAGAGCCGACGTTATTCATCGGCACGATAGCGGAGAA
CATCGCGTACGGCCTCAATACCATGCCGAGCATGGCAGAGATCGAGACCGTGGCGAAATGTCGAACGCGCATGACTTCATCATGCAATTCCCGGACGGCT
ACAGCACTCAGGTCGGAATGAAGGGCGAGCAGTTGTCGGGAGGCCAAAAGCAGAGGATCGCTATCGCTCGCGCCATGATCAAGAACCCCAGCATTTGCTT
CTGGACGAGGCGACGAGTGCTCTGGACTTGGAGAGCGAGAAGATCGTGCAGGAGGCGCTGGACAAAGTTGTGGCAAGCCAACGCCGCACGACCATCGTCA
TCGCGCACAGACTGTCGACGATTCGACACGCCGACAAGATCTGCGTGGTCAGTGGTGGCAAGATCTCCGAGCAGGGCACACATCAAGAACTGCTAGGTCG
TCGGGGGATGTACGCAAAGTTGGTGGAGACAGCCTCGTCGTAGGGA