Description :
From Genome Similarity Track
Location :
contig_44:403722- 407568
Transcript NameFunction/comments
g9853.t1hypothetical protein

Sequence
3846 bases(100 bases per row)
ATTCATGGCAAGTTCGCCTGAAAAAGGTGGCTCCAGTGAAGTGCCGTTCGCCCAACTGGTGACGCCACGCGCTGATGCCCCCAATTTCGTTGAAATCGAC
AGGAAAACTTCACAATTCTTCAGTGACCAGCAGAAGTTAGCGTCCAAGTTTTCGTTCCTGGATCTGTACCGCTTCGCGACGCCATGGGACCGCGTGCTAA
CCATCACGGCCGTCCTCATGGCGGCAGTGAACGGCGCACTCTTCCCGTGCATTGCGTTGGTGTTCGGCAAAGCCATCGGCGCCTTCGCCCAAGTTGGCGG
GGGCGTGGATCGCGGTACCTTAAACAGTGCAGCTCTGGACTATTTTCTGATAGCCATCGGGCTGTTTGTGACGGACTATTTGGCGTATCTGCTGTTTTCA
CTATCGGCCGAGCGCCAGATGAAGGCTCTGCGTGCTCGAGCGCTGCAGCACATGCTGTACATGGATATTGCGTGGTACGACCTTCACGACCCACTGCAAT
TATCTACGAGAATCACGGGAGATACTGTCAAAATCAAGGACGGGATGGGGGAAAAGCTGGGCAACGGCATCAAGTATATATGCCAGTTCGTGACGGGCTA
CATCATTGGGCTTGCTCGCGGTTGGGATACTACGCTGGTGATGACGTGTGTCATTCCTGTTATGGGCTGGTCGATGGGATTTGTCATGAAAAAGTGGCAA
ACGAGAGCCACCTACGCACAGCAAGTGTACGCCCAAGCAGGAGCTGTGGCGGAAGAAACGCTGGGCGCCATCCGGACTGTAAGTTCTCTAACGGCTGAGC
AACGCGCGTTGGACAAGTACAACCAGCACACTGCCGAGGTCGAGAAAGGGAACATCCAACAGAGCAGAATGCTTGCGCTTATGATTGGCCTTTGCCGGGC
CTGTGACTGGCTCATGTATGCCGCTGGCTTGTGGTACGGAGGCTCCAAAGTGTGGAGAGGAGAAGCCTCGCCGAAATCTGTGTTCCAGGCGTTGATGGGC
ATTCTCATGGGCATGAGCTCCATCGGACTCATTTCCCCAAATCTTACGGCTATCCTGGAAGCCAAAGGCGCCGCTGTCGCGCTCTATGGGCTGCTGGACA
CGCAATCTCACATTGATGCATCTCAGGCTGATGGAGTCGCTCCCGACTCGTGCTCGGGTCGGATTGAGGTTGTTAACGTCAGCTTTGCCTACCCAAGTCG
TCCGGACGCTCCCATTTTGAGAGACTACAGCGTCACCATCGAAAGCGGCCAGACGGTGGCGTTCGTGGGTGCCAGTGGTGGCGGGAAGAGCACCATTATC
TCGCTGCTGGAGAGGTTTTACGACCCGACAAGTGGGTCGATTCGGCTGGATGGGCGCGATATAAGGACACTCAGCGTGAAATGGCTCCGCTCTCAGATTG
GCCTGGTGTCGCAGGAGCCCGTGCTGTTTGCTACAACCATCGGAGAGAACATTGCTGCTGGTAGAGCTGACTTTACGCGCGAAGATGTCATCGCTGCGTC
GAAAATGGCCAACGCGCACTCATTCATCATGTCGTTACCCGAAAACTACGCCACTTTGGTGGGTGAGAAGGGTGTTTCGTTGTCTGGAGGCCAGAAACAA
CGAGTAGCAATCGCTCGAGCTGTCATTCGCAAGCCCAAGATCTTGGTTCTGGATGAAGCGACGAGTGCGCTGGATGCTGAGAGCGAGCAGATCGTGCAGG
AAGCGCTGAACGAGCTCATGGCCAAGACAAGCATGACAACACTGGCCATAGCTCATCGGTTGAGTACGATTCGACACGCAGACAAGATCGTGGTGCTGGC
CGACGGCCATGTCGTCGAAGAAGGTCCTCACGACGAGCTGGTGGAATTGAGCACGGCGTGTACCGCAACTTGTACACGATCCAGGAGACAAAAGCCCAGG
AAGAAGCGTCTCTAGCTTTGTCGGACACAGAATCAGAGCAGCAGAGCGGTGGTTTGGCTGCGGCTTTGGCACGAAAAGCAAGCAATCGGTCCATGAGAAG
TGAGGAGGCAGATACAGCGGCCATGCTGACGCTGGTGGCGAGTCAAGCGATCCTGCTCCGCGAAAATTTACGTTGAGAGACGCCAACGCCCTGAGCCAGC
CAGAGCGCGGGTATTTTATCCTGGGTATGGTCGGAGCTGCAGTCAACGGTGCCTCGTTTCCAGCGTCCGCTGTTCTTATCAGTGAGCTGGTGTCGATTAT
GACGACCGACTACGCTTACTATCAAGAATACGACGATCGATCGTACCTATCTTCCTTGCCGCACAGAGTGACAGTGTACGGATGTCTGTATATTGCTGGA
GCTGCGGTTCTGTTCCTCGGCCGTGCTGCTCAGAGCTACGGGTTTCAGTATATGGCGGAGACACTGACGGCTCGCCTCCGAGGGATCACTTTTCGTCTCT
TTGCAGGCAAAACATTGGCTTCTTTGACAGGACGAGAACGCGACCGGAGCGCTGACGGCTGACCTAGCGACAGACGCTCTGCGCGTCGCAGTGATCTCTG
GCGAGACTGAAGGACGATTGTTCCAAGCGATTTTCACGACGGTCGCGGCGCTCTTGATCTCGTTTCTGGCTGGGAGCTGGCTTCTCTCGCTCGTGATGCT
TGCGATCATCCCATTCCTCGTGCTAGGAAACATGTTCCGAGGCAACAACATGCGCGGGAAAAGTATCCTAGCCGATGATATGGCGAGGTTGGCGCGCATG
CGTCTGAAGTGCTGGGCAACATCCGGACGGTGGTGTCGCTGGGTCTCGAAAGCTCGTCCTGCGATAAATTCTCGGTGCTACTAGATGCCCCCATGAAGAG
CGGTGAGCGAGACGCACAAGTGAATGGCCTAGCAGTGGGCTTCAGCTCCTTTATTGTCTTTGCGACGTACGCTTTCGCCTTTTGGTACGGCGGGAAACTG
GTGGATGACGGATCGATTTCCTTCTTGCAGCTGATGCGCTCGCTCATGGCGATCATCATGTCGTCCATTACAGTTGGAGGCTCCATCGGGTATCTCGCGG
ACACGGACAGCGCCTTTGAGGCTGGCGGGATCATCCTTTCGCTTCGAGACCGACCGCTACCCATCGACTCGTTCGGCGAGGAAGGTTTGCAGCCTCACAC
CGTCGAAGGGAGAATCGAATTCAAGGACGTACTCTTCCGGTATCCGACAAGACCAGCGGTGACAGTACTGAAGAACTACAACCTCATTATCGAGCCTGGA
GAGACTGTCGCGTTCTGTGGACCCAGTGGCGGCGGCAAAAGTACGTGCGTGGCGCTACTCGAGCGATTCTATGATCCTATCCACGGCCAGGTTCTGCTCG
ACGGAGTGGACTTGAAGCAGCTGAATGTGCGCTGGTTGCGGGGTCAACTTGGTCTCGTCGGACAAGAGCCGACGTTATTCATCGGCACGATAGCGGAGAA
CATCGCGTACGGCCTCAATACCATGCCGAGCATGGCAGAGATCGAGACCGTGGCGAAATGTCGAACGCGCATGACTTCATCATGCAATTCCCGGACGGCT
ACAGCACTCAGGTCGGAATGAAGGGCGAGCAGTTGTCGGGAGGCCAAAAGCAGAGGATCGCTATCGCTCGCGCCATGATCAAGAACCCCAGCATTTGCTT
CTGGACGAGGCGACGAGTGCTCTGGACTTGGAGAGCGAGAAGATCGTGCAGGAGGCGCTGGACAAAGTTGTGGCAAGCCAACGCCGCACGACCATCGTCA
TCGCGCACAGACTGTCGACGATTCGACACGCCGACAAGATCTGCGTGGTAAGTGGTGGCAAGATCTCCGAGCAGGGCACACATCAAGAACTGCTAGGTCG
TCGGGGGATGTACGCAAAGTTGGTGGAGACAGCCTCGTCGTAGGGA