Description :
From Genome Similarity Track
Location :
Scaffold_13:403647- 408775
Transcript NameFunction/comments
Physo_308580transmembrane protein, putative
Physo_419675TPA_exp: putative tyrosine recombinase
Physo_532265Hypothetical protein
Physo_532253PREDICTED: uncharacterized protein LOC101783602 isoform X1

Sequence
5128 bases(100 bases per row)
GCCCAGGAGCTGGTAAAAGACGATTCCACTGAGGGAACTGGAGATCACGTGGAGGTTCTCTACCGACAGCGTCTTCGACAGTTTTGACCAAGTAGTCGAA
GTCTCTCTCCAAGTCTGAGCAAGTGCGGAGGCGGTAAGCTGAGCCGCATCCACTAGCACCAAGGTCCTGATTGAGAGCGATTGGCAAGTCCTACCTCTCC
ATTTGGTGGAAAAATACATCTTCGACGGGATAATCGGCGGGATATCTCTAGATAGTCGTCGATAAATTGGAATCGGACTTGGAGTGGTCAGGTAACTCCC
GTTGCCCGCATAATGCCCGACTGTCCCCCGAACGAGGCCCCGAAGCGAATATTCTGTTCTGGGGGCGAGACTTTGTGTCGCTGACGTTGATGCCGGGAGC
GGTTCTAGAGCAGTACCGAATTGCTCTTCCGAGCTTGAACATGACGCGACGACAAGCTGCTACGATAGCAGTCACGTCAACTGTGTTCCCACAGACGTCC
AAGATCGGAATGTCAGCTCTCATCGGGTTCCCACTTCCTTTCGCTCTCGTTATGGGCGTAGCAGGGAAGATGGTGGTTGTCGTTTGGAGCGGCGTCATTT
TGTTCGGAGCGAGGATGAAGAGAGACGCAGTGCTGCGCAAGGAGCTTCTGAGCTTCATGAACGTCGTCAACGGCCCGATGCTTCCTCATGCTTTTGTATC
CCATCTATCTCTACGGCTTCATCCACCTGGGGCCTCTTGGACAGACCCTCTATCTTGGTCTTCTACCCGTCATCAAGCTGGATAACAAGTACGACTTGAT
GGCCCAGATCGTAATTTTCAACATGGACGTGTTCAACGCGATGTACGTCTCCAGTTGCATCCAAAGCGCGAAGTCCCTCAGTGCCATTTTGCTCTCGGTT
GGACTGGATATCCTGTTTGCAGGGATATCAATGTACGACGTCGCAGCGATGGCGAAAAGAGTGGGTCTCCTACGACGCAAACTGTCAGCAAACCATCCAT
TGAGATTCGCTAGTGCAGTCCAAATTGCAGCGCAGATTATCAAAGAAGACGACCGGGCATGACTTCGGCTGTCGCAGCGTCGATACCTCATCGAAGCAGC
GGTGCCCAAGCTGCCCGACAGTAGCGAAAACTCAATGGGTACTACCACTGACACTGATGGAGCTGTAGAAGTCTACACGAAGCCAACCATAGAGGCAGAT
CTCGCTATTATTTCAGCCCCCGAGACGTTGAGTCGCGTGTTCTCGGACAAAGAGCGACAACGGTTCATTGATCGAGCAGCGCAGCTACTTTTCACCTCCG
AATTTGTCACACCACTCGCGCTGTATACGAAATTTGTTGTCCCATTCATTTTTGGTAAGTGTCGTTCGTCAGTACTCTGATTGTGATTTTTTCTTCTACG
GTAGCTTATAAGTGCTGCTTGTACCATTGCAGCCGCATGCACAGCTATCCTGTTCCACTTGCCGAACCACGACTATGATGATGCCGTTCTCAAGGAAAAC
ATAAGCTGCGTGGCAATGTTGGGCGTCTCCGAGCTTTTGGTGCTTTTGGTGTGTAGCGCTATACTCCAGCGAAGACTCGACATTCCCATGCTACACATGG
TCTCCTTTGGGCTTGCCTACGGGGGGAGGATGGTGCAAACGAACCTGTTCCTTGCCATATTCTACCCCATCCAAAACTCACAATGGTACGCGGCTAGCAT
AGAATTCATCACTTGTACAGTACACTACACTAAAACGTGCCTTTTGCTAACCTCTTCTGCACCATTAAGGGGCTGACTTTAGCTTTGAATTGAGCTGGCT
CAAGCATTAGTCGACACCCTGAAATACTGTTCCACACCTTCTATAGCTATGTCTTTGCCACTGAAACAAAAAAATATTTCGTAAGATTTCTGGTGTTCAA
ACATGGCACTCCACGCCCTCGTGCGTGGCCAGGCGCCAGTAACAAAGCTGTTTGGTAAGTAAACACGTTTTTTTCTGTCATGGCAAATTCCCGCTTGTTG
GCAAGTACATGGAATCATTTGAACTACTTATATATAAATCTTTACTTAGTACTTAAAGTTCTGATCATTTTCAGTCGTCGTCGTCGTCTTACTTGTTGGG
GGCGTGCCGAACCCGGCACAAAAGTTGAAAATTACGTTGCAGCGCCTCCACAGTCGGGGTGTGGCGTGGAGGTTGCCCCTTGATTACGCTGCAATGTTGC
CTTGACCATCATGTCGCCCGCCATCCGTGCTGTTAGTTGTGAGCTCATTCTTGTGTACCGCTCAATGGCGTCCGATCTCCACCTCCCGAAAAGCTTGATG
GCCAAGCTGTCGTAGCCCGCATTGAAGAGTGCTGAGGCACCTCCGCTACGAAGTGAGTGGGAGCCGTAACTGTCTGGTTCGTGCCCAACGAGTTCAGCTG
CGTGTTTCAAAGCACTGACGAGGTCTCGGACTTGTAAGTTGTGGGTCCGCGTAACTTTGCAGAGTAGAGTGTCCGCCTTCGCGCCAATGGAAAGGTGATG
CTGAACGAGATACCAGCACGCCATTACTGGGCAGCATTGGGCGTGACCAGACCGACCCAGCACACGAGTACATCCATCGCCAAACTGGTCAGTCTTGCTG
CCTCGAAAACGAATTTGAACCTTTTTCACTCGATCGATCAATTCTTGGTCGCGGCCTTGATCATCCAGGAAGCGTACATCGGACCTTTGAATAGCATATT
CTTTTACCCTCGTGCCGTCAGCTAGATACTCGGAGCGGCGCAAAAGAAAGAAGAAGCCCAGCACTGAAGCCCCCCAGATGACTCGGTGCTGGGCACAGGA
AAAATCGAGGGAGTTGTGCAATTTTCCGAGGAGATGCATGGTGACGGGGGCCATGGGGTTGGTTAGAGGGTCTTCTCTGCGCATGCCGACGACAGCAAGT
TGGTGTCCGGGGGACAGTCCGACTTTGTATCCGACGAAGCGCTTGTGATACCACGAGATGTGGCAGAGTTTGGAGAGCACGGTGGAGGTAGAGTTGCCTC
TTTCGGACGAGTTCCATCCGAATTTCCAGCAGTAGATTGCGAAAAGTGCGAGCTGATAAAATGAATGGCGCTCTTCGTCCTTGGGTAACCATTTAGGCAG
TCGCATTTCCGTGCACCATCGCACCCACTGTGACCAAGTAGCTGAGTATTTAACGTTTGATGGCGAGGCCAGTGAGCGGGATTGAAGTCCTTCGAGAAGT
TCGTGTAGAGTTTGCGAAAGATTGGCGGCACGGCTGTCTGTTCCCACGACACAGAAAAGTTAGTCCACACAGTTTTATAAGGATCCGTCCAGGCCCTCGA
TGCTGCGTCTGCCATGGTGTTGGTCGACCCTGGTAAATGCTCCACCGATACTCGTAAGTTGAAGTTGGCTTCGGCTAGACCAATTGCCCTGTTGATTTCT
TGGCTGAGTTCATTCTTTGAAGAAAGTCAATTGCTCCACTGCACTGCTGAAATATTGTCACTCCAGCACTTCACGTGAAGCATTTGGCCGGACGAATTGC
TCGACCACGACGAACCCCAGGTCCACAGTGCCAATGCGATGCACAGATGCTCCCGCACATTAATGGAGAAGCTGTTGAAATGCGTGTCATCGTTGGCGAT
TAGAAGAGTCTCGGTCTCGTCAAATTTTTCTTGGATAAATTTATTTGCGCCAGGGTCCAGAATCGCCAAACCCCTGTAAATGCATAAAGACATGATGTAG
CCTCAAGACAAATGTACCTGGACTCCATCCAAGTGGACTGGTCTTATGTCAAAAGAAAACTCGTCCACTCTTCACAGAATTCCTACCGAAATTGTTTTTT
TCTTTCTCTATGGCAGCATCACTTCTCACAAGGCAAGAGTTCATGCATTCGCATTTGGCATCGCTGTTCGCGTTTTATAGAATTATACTCTCCACGATAT
GGCTTCCACTTCTTGCTTTACTATGCGCGCTGCAGAGACCTTTAGACTGCACCTGTTTGCCGCACCCAGGTTCCGAGCACTGCTTCCCTCCGCCATGCTC
AAAGCATCTGCCCGCCGACCGAGACGTCTTGGTACAGTCAGGGAACGAGCAGCTCCTGGATCCTCCGTGGGTTATGCACAAGCCGTGCAGCTGAGCACTC
TTGGTGCAGTCCGGATGCACGCAGCGCTTCCCGCCGTGGCTCACGCACAAGCCCTGGGACTGCGCAAACTTCTCGCAGCCTGCGCGGGAGCACATTGCTC
GCTTGCGCGGATTTCGCGTCTGCCCCGCTGTACTCTCCTCCTTGGTCGGGTCACTTTCGGTTCCCTGTACGTTATCCTGTATCACCTGTTGCCTCTCCAC
CTTCACTTCAACCACTTGGTTCGTCGCTCCTTGCTGCGCCCAGCCGTTCACCAGCAGCGACATCATCGACCCGTTGCTCTGCTGCACCGGATTCGGGGCC
ACAGGGACGACATAGTTGCTGTACCCCGCCTGGATCGGATATCCCGGGGCGGGGTAGCTGACCTTGTTGCTGCCGTCGTTGTAGCCGATCCAACCCGCTG
CTTGACCTGCCGAGCTGACACTTGGTGCTTCTAGCCCCGGTACCTCCTTGGGCCACTCGTTCAGCAGCAGCGACATCATGGAGCTGCCTTTCCCCGCGTT
CGCGTTATCCTGTATCGTGACCGGTTTAGCGTCGACGTCGCCCTTGGACCGACTGGGGCGTCGTCGTCCGCCCCCGTGGTCTCCGCACTTGCCCTTGGAC
GTGACGGTCTTGTTGCAGCCTGGATGGGTGCACACGCGCCGCCCGCCGTGCGCCACGCAGAGCCCCTTGTACTGCGCCTGCTTCTCGCAGCCCTCGCGCG
TGCACTGGCCCACGCCCGTGTGCGTGCGGCACTTGCCGTTCGACTGGGCCTTGTTGACGCAGCCGACCGTCGAGCAGCGCGCGCCGTCCCCGCGGCCGCC
TCGTCCTCCGCGCGCGCCCCGGTCCGACGTCATCCAAAGCGGCAATGGGGCGATCGATGCCAGTCAAAGACGCCAGTCAATACAGGATAAGGACGCGGAG
CCTCGCCTGGTCTGACTGTGGGCTAATTATGGATAAGGCAGACCAACGTCAGAAGGTGGTCATGCTCTTCAACTGTAATACATTATCTATAGAGCATATC
GGGATAAAGCGCAGCCGATATAAGAGCA