Description :
From Genome Similarity Track
Location :
contig_3:403559- 405229
Transcript NameFunction/comments
g926.t1XP_008901970.1 hypothetical protein PPTG_08966 [Phytophthora parasitica INRA-310

Sequence
1670 bases(100 bases per row)
TCCAAACCAAGCGGGGCGAGCCTATTCGTTGGCCGTGCTGCGTGCTGGACAAGAGCGCAGCCACGGCAAGTGTCTCGGTTCCGATGCCCACCTTGGTGGG
CATGCAGCGGACCTCCTGTAGCTCCAGCAGTTCACTTTGAAATTGGCTGCTGACGACGCAGTCCGCAAGTCCCCGCCAACCTCGCAGCAGCATCGACCGC
GACACCATGGCCAAACAGCCCTTCTTCACGTTCGAGGACGCTAAGTTCTCCTTCAGCCTCTTTTGCTGCATGTGCGGCGTCGGCACGCTGAGTATGCCGG
CCAACTTCGCGCGTGCGGGCCCGATCCTCGGATTCTTCGCCACCGTGTTCATGGCACTCGCCAACATCTACGCATCCGTCGCAATGTCCAAGGTGCTTCT
GCTCGCTCCCAACTCGGTCAACACCTTCAGCGACCTCGGTGAATGGTGCATGGGCAAGACCGGCCGCTGGCTGTGCGTCATCTCACAGATGGGTTCCTGC
CTGCTCATGCCGTGCGTCTTCCTTGTGCTCGGCGGCGGTGTACTCGACGGACTCTTTCCCGATGCTTGGAGCACTACGACCTGGATCATCCTCATGACCA
TCACAGTGCTGCCGCTGGCTTTGGTGCCGACCCTGAAGGAAGGTGCTGGTGCGCTTTCGCCGGCTGCATGGGTACGCTGATTGCCGACTCTATCGGCATT
GCAATCGTGGCCCACGGCATGAGTGACCATCCGTCCGTGCCGTCGCCCGAGTTCAGCCTGTCCCAGGTCGCCGGTGCGTTCGGCAGTCTAGCCATGGGCT
TCGGTGCTGGCATTGTCCTTTCGGACGTGCAGCGTCAGCACAGTGACCCGAGCCGCATGCCTCGCGTCGTCACCGTCACGATGGTCTTCATCATGTGTCT
GCTGCTGGTCCTCGGTTTCGTGCCGTACTTCTCGGTTGGATGCCAAGTTTCGGGCAACCTGCTGTACGTCATCTACCCGGACGCCACCACCGGCCTCACA
ACGCTGGGCTTCGCACCCAAGTGGGGCACCGTCGTGCTGGCTTACATCGCCATGCAGATGCACGTGACCATCGCCTTCTCGGTGCTCATCAACCCAGCCT
TCTACATCGCTGAGCGTATGGTGCTGGGCATGCACAAGAAGCAGTCCGAGGAGATCGAGAACGGCCTCGCCTACCGCGAATCCGGCACGCCTTTGCCTGA
CCTTGCGAAGACGAGCGAAGTCTCTCGCGTGAGCATGACGTCCAGCCGTCGCTCGAGGACGTCGGTTTTTCCTCTTACCGGCGAAATCAACAATGACCAC
GAGCTGGAGGCCGCCGAGTACCGTGGCGCCAACGCGATCAAGTACATCGTGCTTCGTCTCGCCATCATCGTGGTTCTGGTGATTCTGTCTATCATTTTCA
AGGACCACTTCTCGGACTTCGTCGACTTTGTGGGCGCGTCGGCCATCACGGCCAACTGCATTGTCCTGCCGACGGTCTTCTACCTCATCAAGACGTGGGA
GCACGTCCCCATGTACGAGAAGTTCGGCGCTGGCGTCGTGATCGTAGTGTGCACTGTTCTCGGTGTCTACTCGACGTACACCGCTGGCAAGCACCTGTTC
TTCCCGTCAGACTCGGACACCCTCTTCCCGTACTGCGACGCCGAGTTCCAGGACACAGTGTACTACAACC