Description :
From Genome Similarity Track
Location :
contig_14:403501- 405236
Transcript NameFunction/comments
g3549.t1hypothetical protein

Sequence
1735 bases(100 bases per row)
CCGTTCACATTGAGCTGGTCCAATCTCTGCTACACGGTGAACACGAAGAAGAAAACGCCGACGCACCCCGACGGCAAGAAGACCATCCTCACCAACGTCA
CTGGACGATGTGCTCCTGGAGAGCTCACGGCCGTCATGGGACCGTCCGGCTCGGGCAAGACCACACTGCTGGATATCCTCGCTGACCGAATCGGCTCGGG
TACAATTCAAGGGGACATCGCCTTAAACGGAGCGGCCCGCGACATCAAGACGTTCCGAGCAGTCTCGAGCTACGTAGCCCAAGAAGATTCCCTGTTGGGG
TCTTTTACGGTTCTGGAGACGCTGGAGATGGCAGCGAACCTCAGTTTGCCGAGCTCCATCTCTCACCGCGAGGTGGTTGAGCGCGTGCAGAATGTCATCG
ACGAGATGGGACTGCGAGTGTGTGAGCACGCCCTAGTCGGGGACATGTTCAGGAAGGGGATCTCGGGCGGCCAGAAGCGGCGACTGAGTATCGCCATTGA
GCTGCTGTCGGAGCCGTCGATTCTACTACTTGATGAGCCAACGTCGGGCTTGGACTCGGCCTCGACATACAACGTCATGAAGTTTGTCACGCGGCTCTGC
AAGGAGAATATGACCGTGATATGTACCATCCACCAGCCTTCGTCCCTGGTCTACGACATGTTCACGAATGTGGCCATCTTGACTGCAGGCCAAACGGTCT
ACTTCGGGCCACGCGTGGACATGTTGCCGCATTTCGCGTCACTAGGCTACGTGTGCCCTGAGCACGAAGACCCCGCAGAGCATTATATCAGCATTGCAAA
CACCGACTTCGAAGGCCATGGGGACATTTCACTGCTGGTGTCAGGATATGCAGCCAGCCCCGTAGCTGCTCGTATCCAAGAGGCCATCCAAACGGATTCC
ACCAGTCTACCTGCAGCAAGAGCGACTGAACGCGTCCCAAACTCGCCACTTCGACAACTCGTTGTGCTGCTGAAGAGAAACTCGCTCGACAACCTCCGCA
ACCCCGGCATTTTTTGGGTTCGACTTGTCATGTACACGGCGCTTTCGGCAATGATGGGGACGATGTTCCTGTCTACAAACGACGGCATCACGGCTCACGA
CCAGGTGTATCTCCTCACGTACGCCAACTGCTTCTTGGTGTTCATGTCCATCGCCGTGCTGCCGTTCTTCATCGAACAGCGCGCCGTCTTCCTCCGCGAA
CGGACAAACAGTAACCTCAACGTCTTCAGCTACGTGATCGCCAACTTCTTGGGTGCGTTGCCTGGCATCTTCCTCATCGCGCTCACGTCGACGCTCCTGG
TAGGGTACCTAGCGGACCTCAATTCGTACGGCGTCTTCCTGCTGACGATCTTCCTGTCCCTGGTGGTCGCTGAGAGTTTGATGCACCTCGTTGCTGCGTG
CGTGGCGCACTTTATCATCGGCATGGCGTTGGGTGCTGCCATCTTCGGCTGGTTCATCCTGTGCATGGGGCTCTTCGTGCCGCGACCTGCGATTCCGGGC
TACTGGATCTGGGCTCACTACCTCGGGTTCCTGTCCTACGGCTTTGAGGCACTTATGCACAATCAATTCCACACCGACAGCGACCCCGCAGCCCAGTACA
TCCTGGACAGGTTCGGTATGGAGAATGTCCATCTGGGACGTGATCTGGCCATCCTAGGATCCAACGCGGTGGCTTTCGAGATCATCTTCGCGTGGGTCCT
GTTCAAATTCCACACTGGACGTCGGTAAAGAACGC