Description :
From Genome Similarity Track
Location :
Scaffold_57:40345- 41990
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G014028Similar to HSFA2B: Heat stress transcription factor A-2b (Oryza sativa subsp. japonica)

Sequence
1645 bases(100 bases per row)
TCTCGACGCGCATCTGGTGCTCCAGCGCGGCCTGCGCCTTCTGCACGAGCAGCGCTAGCAGCGAGCGGTTCAGCGATTTCTTCACATGCGGCGGGATCCG
CTTCTCAACCGAGTCCTGCACGGCGCGCGGAAGCTCTCGCGAGATGAACTTGAGGATCTCAACGCGGTACATGCACGCGGCCTCCGAGTGCCCCTGTTGC
GCTCGTCCAAGTGTGGGGGAGCTTGGTTCCTGGACACGAGCGAGGAGTTGCTGAATGTCCGACACGACGGCGTCGGCGACGGCATCGACCTCGCCTGGCG
CGTGGTTCTGCTGAATGCGGATGAAGCCCAGGATGCGCGCAATGATGCAGTCGAGGAGCTCACTGCGAGTCTGCGACGCCGTCATGCTGAGCTGCCGCAC
GGCAGCGTCTGGCGTGCTTCCGCTTCGATGCGTCGCTGGTGGTGTACTACTCGAGTACGCAGCGTCGTCGCCACGCGCACGCTTGAGTCCTGGCATGGCC
ATGCTTGATCGATCACCACTGAGACTTCCACTGCCGCTGCTGGTGGGGTACGCGTTCGGAAATCGCTGCTGCTGATGGTGAGTCTGCTGCTGGTGATCGT
ACAGATTGTTTCGCGTGGTGGCGTACGAATCCCAGTTCACGCGGTCCACGTACGATGTGCCGGCAGGCGCACTGCCTGGTCCACTTCGGATGGACACTAC
AGGGCTCAGATGGCTTGCTGAGATGGACAGGTGGTGGACACTCGGTATCACCGACTGCAGTGGACGCAACTGGTACGTTGACGCAGGAGTCGACTTGTCG
TGCGGCGCACTGCCGCCGCTGGTGCTGCGACTGATGGATCCCGGGATCACTGCTGCTTGCGAGCTCTTTCCTCCTGACGCGCCGCCTGATGGTGGCAGTC
CCTGATGGTGGAATTGCAGCAGCGGGTGGCTGTGGCCTCCCATCGACGGCAGCGTTTGCTGCGGAGTGGCTGCTGCCGATGCTGATGACGGCGTCGATGG
GCGATCCTGGCGGTACGAAGGCAGGGCAGAAGAACTGCTGCTACTGCCACTTGACCCACGCGCCATCATGGCCTGCATCATGCTCATCATGTGCTTGTTG
AGCTGCTGCACTTGTTCGCGCAGTCCGGCGACTTCGGTGCGCAGCTCATCCATCTCGGCGCGCTCGATCGTCGAGCGGCCATCGGCGATCGTGCGGCGCT
TGATCTCGCGCAGCAGATCCTTGCGGCCGCGCACAAACTTGTCGTGGCGGAACTCCCACCACTCCTTCGGGTCCACGTTCGCAGCGGTCTCAGCGTCGAC
ACGCACTTTGCGGAACCCGTAAAAGTTGAGCTGCCGCACAAACGAGCTGAAGTTCTTGTGCTTGAAGTACACGGGGATCACGTGCTCGGCAAACGCGATT
GGCTTCTTTACGATGAAGCTGTCGCCGAGGGGCGTGGACCACGCCGCAACCTCTGGTGAGCACTTTTCGAGCATCTCGTACGTCTTCTCCAGAAACATCG
GCGGGTCCTCCAAGCGTCTTCTCTTGGAGGACACCGACACCGTGCCGCCTGGTGTGATCACAGTGGATCCTTCGCTCCCATTCGGCGTGTCTAGTCCACT
GGCGTCCGCGGGGGACGTCGGCGCCGACGCGACGGACGTTGGTGA