Description :
From Genome Similarity Track
Location :
Scaffold_1077:40328- 43675
Sequence
3347 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNATCCATCCGGATCCTGACTCGACACTCTACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTGGGACAGTGGGCAGCTTTAC
TATAGCCTTGGACACTGGAGATTGTGAAATGTTCGAAGGGGGAAGACGAGATCCTGGGAGTCTTGGACGCGAGCATCACTCCTCGAGCTAACGTGGATGA
GGCGCTGACTAGGATCGCTCCTAAGAAAAAGCCCAAACGCCGGATCCAGATCCTGATCCCGACGGTACAAGTGGATGAGGATCTGTACGTCCTGAGTTTC
GATGGATCCGCTCGCGTACGACGCGGAGGAGGAGCATACAGCGCAATACTGTGGAGACTGCCCGGATGAGAAGTTATACGGGCCAGATCCACTTACGCGG
AAGGTCTCACCGTCAATGAAGCGGAGTATAACGGGCGCCTGCTGGGTTTGGATCTACTAAGGGACAAGATCCAAAAAGGCTGGTGATTTGTGGGGATTCA
AATTTGGTGATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGTGGTTGGGTTG
AATCACGAGTTGGTGTATGTCAAGCGAGATTGGAATGCCAGTGCAGATAGCTTGGCCCAGCGTCGCTTTACGGAATCAATGTGGTGTTGAAGTGGAGAGA
GAGGCCGAGCATCAGGATCTCGTTACGTTGAACCGACTAGACGAAGTGGTGGTAGTGGGATCCGGGAAAAGGACAGTCCAGGTGATGGCCGTCACTAGGT
CCAGAGGAAGGATTGGATCCAGTCCCCAGATCTTCGAGGAAACATTTGTGAAGAGAGTCCGCATTGGGCGGATCCTCAAAGCACAGGACGAGGAAGCGTG
GATCCTAGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAAGATGCCAAACCCTACAGCATTATCGCTACGGATTACGCGGTGGAT
CTGAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCAACGAGGATCGGGATGGATTGATGAGACTGGTGATGCCGGAAACCTTACAACAGGATG
TCCTACACCACTATCACGCTAGCTTGGAAGGCGGACATCGGGGTATTGGTCGGACCTACCAACGGATCCGGGAATGTTTCCACTGGAGAGGACTATTCAA
GAGCGTACAACGATATGTCGGTGAATGTGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATGTCCAAGCGACTTAC
CCTTTCCAAATCATAGCCATAGATCACATCCCCTCGTTGCCCAACTCGTTCATAGGAAACACAGAATTGTTGATCTGGGTGGATCTGTTTACCGGATACG
TGATAGCCAAAGCTAGTGCGTCTAGAACTGCACAAACCATTGCCGAATCGTACGAGGAGTGCGTTTTCCGAAGATTTGGGGCTAGTGAGATGATTAGACA
TGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGATCCTGGGGCAGAGACAGCGGACAACCATGACATATCGTCCCCAAGCTAGC
GGATCGGCCGAGCGCATGGTGCAGACGATCACGAGGGCACTCAAGATGCATGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGACTCC
CCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGACACCCCATTTTACTTGGCACATGGGTGGGATCCTAAATCCACCCTAGAAGTGGCCATTCC
GGTATGTAGCACCAAGAAGAGAAACCGAGATCCAAGACGATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCCAGATCCCAAGTGAACGAACGGCTG
CGGAGTGCGATACAAGCTCGAGCGGATCGACACAACAAAGACGCCCGTCCACGTCAAATCCAAGTGGGATCACAGGTGTGGCTTTATTTAGATCGGGTGA
AGGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCATGGACCGTTCCGGGTGAGCGAAAAGATAGGGGAACATGCGGTGAAGCTGGAAACGGCAGGTAC
CGAATATCGCTTGTTCCCTGAAGTACACGTATCCAAGCTGAAGTTGGTCAAGGAATATACAGATCGGCCGCAAACCCGTCTTTCGGTGGATGAATCCGAC
CGGGTAGATTTCGACGAATCCCTCCTACCGGAAGATAGTTGGAATGCGGATCTCGAAGTCGACGAGTTCGAAGTTGAGAAGATCACCGACATGAGATCAG
GGAAGCGAACTAGATACGGACAAATTTACCGCGAATTTCTGGTGTATTGGCGTGGATATGACGAACCCAGTTGGGTAAACGAGGCAGCTCTGAACTGTGG
AGCATTACTCTATGATTTCCTGCGGGATCGTACGAATCGGAACAGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGGAAGGGGATATATGGATGTGA
GTTGGTCGAGGCGATGGGAGGATGAAGAAGGTCCCACAGGAAGGGTGTGGGTCGGGAGGAGGAGGATCGCTGATGTGAGTTGGTCACATCGAAAACAAAG
AGAAGACGATTCCATAGGAGAAGTGTGGATTAGGAGGAAGGAGTGAATGGTTATGCATAAAGAGTGACGTTTTACGTGCAAAGAGTCCTGCTTGATTTCA
AGCGCAAGCTTTCGAGAGACCGAACTATACTGACCGAATTGAGACTGGGTCGTAGGCGCTGGATCCGGATGAAATCCAAGCGTGGATCCAACCCGGATCC
AGAATCCAGCCCAGATCCAGGTGTACGCTGAAAGGGTGGATCCAGCCCAGATCCAGGTGTACACTGAAAGGGTGGATCCAGCCCAGATCCAGGTGTACCC
TGAAAGGGTGGATCTAGCCCAGATCCAGGTGGACGCTGGTAGACTCTGACTGGATTCCTCTACCAACACGAGAATGTTACAGACGTATTCAAGTAAGGAA
GCGTGGATTAGAATAGCTAATGCAAAAAGGCCAGCTCGACCCAGTTC