Description :
From Genome Similarity Track
Location :
Scaffold_1323:40322- 43146
Sequence
2824 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGTGTACTGAGTGTCACCACCATTCGGTAAGCAACAAAACCTGCCCACCATCTCAATTTCTCCCAG
TGGCCACCAGTAAAACTCGACGCAAATCATACTATCCGCTCCTGTTTCATTGGTCGTGGATCTCGTGGAATCCGCAGGCTCGTAGTGTCCTTGAACACAT
GACAGGCGATGTAATCTCCACCAAAAGAGCAAGATGAACCTGTCACCAAGCTTGTGAGGCCATTGGGCATCACTATAACCACCCTTATCCGACCGTCGCA
AACGAGATGCAGCCACGAAGTAGTAGCCGAAAGCATTGACGGATCTGCGTGGACCTAACCAAAGAAACGATTTATGATATCATTCAAAAACAGTAGTCAT
AGTCAGTTTTCAAATAGCTTCAACGTACACAGACTGTGTGAGGAGGATCCCCCACGACTGCAAGCTTCAGGTGTAACAATTGCGATAATACCGAACACGT
CGTCCACATCGAAGGTGCACATCCTGTGCTACTAATACACGAACTCGAGCCGGACGTACCATCACGAGACTGATTCTTGATACAGAGACATCGGTCCGTG
TGAAGATTAACAGTTAGACTTCCAGGTCGCAACAACCACTCCCCAGTCCATCGACTTGGCGCGTTCAGGTCCTGGTGAGTGAGGTGATGTATCCAATCTT
GCTGTCGCTGGGCCATTTACAACAGCACACATAGCACTTAAGGCCTTTCTTTAAAGCAACAAGCCCCCTTTATCTGATCACGTACCTGGTATCCCTCTCG
GAATTGGGCTACAAACCCTCGCCAACCCACGAGATTGCTAAGCGGAAACTCCGATTGATTCCACTTCAACTTCTCATCACGCCAAGCGTCCACTCCGTCG
AGAACCGCACTTAGCTTGGAACGGAGTTCTTCGAATGCATGATCACTGTACAGCATGCTTATAACGGCATCACTCAAATCACGCACGCTGCTTTCCGTCA
TTTTCGTCGAAGCCAGAGTGTGCA