Description :
From Genome Similarity Track
Location :
Scaffold_1196:4032- 5051
Sequence
1019 bases(100 bases per row)
TCGCCTTCGCCGCGCTCGCCGCCTCGGCCGTCAGCGCCATCGAGATCCCTGCCGAGCACCACCAGCGCTTCCTCCGCGAGCAGGCCGTCGTTGCCGATGA
GCTCCAGCAGTGGAAGGACAGCGCAGCCGGCCAGGTCGCCAAGAAGCACGGCTTCTACAAGGACTCGGGTGACTCGATCCAGATCGAGTCCGTGACCGTG
GACGCCGACCAGCTCAAGCGCTTCTTCCTCACCAAGCTCAGCATCCTCGAGGCGCAGAAGGCCAACCCGGAGGCCACGTTCTCGGTCAACACGCCGTTCA
CGCTCATGACGGACGCCGAGTTCGCGCAGCACGTCAAGCGCTCGTCCGCCACGGTGGACGGCCTCTCGACGCTTGCGTCTCCCGCCAACAACACGCTCGC
GGTCGAGCCGACCACCAACGTGCGCCGCAACCTCGCCACGACCGTGGACTGGACCACGTCCGGCTGCGTGGCGGGCGTCAAGGACCAGGCCAACTGCGGC
TCGTGCTGGGCGTTCTCGTCCATCGCGTCGCTCGAGACGGCCAACTGCCTCAAGAACGGCGCGCTGCAGCTCTTCTCGGAGCAGCAGGTGACCAGCTGTG
ACACCCAGTCGAGTGGCTGTGATGGCGGCTGGCCGCTCTGGGCGCTCAGCTACCTCAAGGGCTTCGGTGGCGTCTGCACGTCGGCCTCGTACCCGTACAA
GTCGGGTTCCACGGGCTCCACGGGCACGTGCAGCACGTCGTCCTGCACCAAGAAGACGCTCGCGATCTCGTCCGTGACCACCGTGGATAACTCCGAGGCG
GCGCTCATCGCCGCCATCAACAAGCAGCCGGTGGCTGTAGGCGTCGCGTCCGGTAACAACGCCTGGAAACAGTACAAGAGCGGTGTTCTGTCGTCGTGTG
ACTCCACGGATCTGGATCACGGGGTGCTGGCCGTCGGCTACGACGCCACGTCGTTCAAGCTCAAGAACCAGTGGGGCACGTCGTGGGGCAACAACGGCTA
CGTCCAGCTCAAGCGCAAC