Description :
From Genome Similarity Track
Location :
Scaffold_222:403135- 406612
Transcript NameFunction/comments
Aphin_H310_13577phospholipidtransporting ATPase putative

Sequence
3477 bases(100 bases per row)
ACCTTGAAGTTGGCCACGAGCACAACAAGCGTGAACAGGACAATGCCGTACTGCTGCAAGTCACCGCTTCCGGCGCCAACCTCGAGCTGGTTAAACCCCA
ACACCGCAACGGCAAAGATCACAACCGCTTCAAAAATTGCCGCCGCAATCCACGTGAAAAACACACTCGTTGTGAAAAGCTCGCCAGAAATCCCGACTTT
ATACAGGGCTGGAAACCGCTGCCCCACGGCCCACGGTACATCGTAGTCGAACACCCCCAAGACACCGATCGGTAACGACGTATAGATCAAGTTGTACAGC
TGAAACCCAACTTCCGAGTACTCCTTTTGCCCCGATGACCCTATGGCCACGCGTCAAGTCATTTCACAACGCATCAGCTCGGAACGTACCAGTCATGTAT
AGGAAAAAGTACTGCGCCAGCACCATAATCATGTTTTTGTAAAACATGTACCCAACCAGCTTGGACATGCGCACGTAGTTCAACCGGCCGTGGTGGAGCA
ACAGCTTTTCCAAAAAGTAAAACTGCGCGATCGCATAGTCGCTCGAGTTGACGGCTTGCATGCCTTCTTGGCCGCAAATGCCGACGCCGACGTGTGCCCG
TTGGATCATGGCCACGTCGTTCGCACCGTCCCCAATCGCCAGCGTTCTAGAGGTCAGGTTTGAGCATTCAAAACCCCAGAGAGGCGCGTCGCATCCCCAC
CGAGCTTTGCGGTTGTTGGTGCGAACCAGGCCCACGACTTCGGCCTTTTGTGATGGCGACACGCGGCAGCACACGACAGAGTCGCACGCCATCGCGACCT
TCAAGAACATGGCACACGTGTCTGCGTCCGCCATCACCATTTCCAACGCGTCGCCGTCAATCACAAGCGACCGGCGCGTGATTTCCACATCTGCGGACAA
CATCTCGTCAACTCTCAGCCACGCCAGCAAGACACGTACGGCTCAGGTCGGCCACGCACAAGTCGAGGCTCGCACGCAGCGCAGTCAAGTCGGGGTACTC
GTCCAAGTTGAAAATGTACTGCATCATGTCGTTGTCCATGAGCTGGCACGCGTACGCAATGTTGATGGCCGTCTCCTGCTTGTCCCCCGTGAGCACCCAC
ACCTTCATCCCGGCCTCCATCAACCGAGCGATCGCGCGCGGCACGTTGTCCTGCAGCTTGTCTTCGATCGCGGTCGCCCCAAGCAGCACCAAGTCTTGCT
CGAGCTCGACCATGCACGCGTCAATGTCGTTTGCCTGGCCGTTCTTGCGCTTCTCGATCTGGTCCAGCGACGCACACGCAGCCTTGTACCGCTTTGTCCA
CTGGTGGTAGTACGCCGTCGGAATCGTCTTCTTGGCAATCGTAAGCGTGCGCAGACCGTCGTCTGCAAACGACTGGAGCTGCTCAAATGTCGTCGCGACC
ACGTCCGAGTCGTTCAACGTCGACGACAGCAACGGCGTGATCACGTTGTCCGCGCCCTTGGTCAGCAGGATGTAGTTGCCACTCGGGTCCTGGACCACGC
AACTCATGCGCTTCCGGTCCGAGTTGAACTCGAGCACGTCCAGCACCTTGAATTCCCACAGCTCGCTCGGCGCGTTCGGGTCATGCTGCAGCGCCTTGTT
CGTGATGCGGATGCGCGCCACGCCCAGCCCGCGCGACTCGAAGGCGAACCCAAAGAACTTGGCCGCCGACACGAGCGCTTGTTCATCCGGGGACGATGCC
GAGTACCGGAGGACAGACTCGCCGTTCTTGTCCGTCGCTTGCTCCGGGATCACCGTGTGGCAAATGGCCAAGTGGAGGAAAAAATCGGCTTCCTTTGTCA
GGGCGTTCGTTCCGTTGAGTGGAATGTCGGCGAGTTTTTGGCGCAACGCGGGGTCGTGAAAGTTCACAAACGGCACGTTTCTGTGCTCGTGTTCACTTTG
GACCTCTGGCACGGGCAGTCCCTTTCGCCGAAGTGCTGCGCGGCCTGTCCACATCGTTCAGGTGGACGTTGAAGTGGTCCCACTCGATCCACCATCCTAC
CGATTTCAGTCGTGCCGAGGCCGTAGCTGACGCCGTTGATCGAGCACTTGCGGAACTCCATCACGTTGCACGTAAGCGTGCCTGTCTTGTCGGAGAAAAC
GTAGGAAATCTGGCCGAGCTCTTCGTTCAGCGCCATGGTGCGCACAATCATGCGCGAGTCGAGTGGCTCGTAGTACATATCGAGGTCCAGCGCCATCAGC
ATCGCTTGGATGAGCATGACCGTTGAGATGGTCACGTACAGCGAGACAGGGATCATTTGGTACAGGAGGAGAAAATACTGACCGCACGCGACAAACCTAT
GCAGCGTCAGCCACGTAACATACCATGCCAAGGCAGGCATGCTTGTACCATCGGTACACGGGCGAGTGGCGAGGCAGCGTGAGGTAGCACGAGTTGGTTT
TGGCGCAAATGTGCGATGAAAAAGTATAGTCCTGGGGGAAAGAGCCCGCCGTCACGATCGCGTGTCCTTCCAATCCCTACCGACTAGGACGTACCCAGGA
CACTTGAGCGGACGCGGCACAAGCACAGAGCACGAGCAACATCGCGAGCAGCCACTTGATCATGACGTTGACGTGGCCATTGATCGAGCTCCACTTGGTT
TCCGGTGCGGCAAACGACTGCATGATCTTCGTATCGGGGCCCGTGTTGATGACGAGACCGTACATCCATTCCGTGTTGCGGAGTTGACACCCGCGCAGCA
GGATGTTTTTGATCGATATCGGGTCGTTCGCGACCGACCCGTCCAGTAGATCAACAAAGAAGGACCCGTTGAAGCGGCTAATAACTTTGTTCGGGACTTC
GCACTCGACGCGGCCGTGGAGGGCGTGGATGTCCGCTTCGGTCTGCGCATGGAGTGTGCTTTCCATGGCTTGCCTGCATGCAACAAAATCATGGAACGCC
ACTCGCTGTGATTGATTCCGTACCGAAGTTTCAGATTCGTTTCGCCGTCCAGCGACTTGGTTTCGACGTAGCATATGCCAGCTTTGTGCGCTGCGTTGAC
TTCGTGCACGGCCAGAATGAGCAAGTCTGCCGGCGCTGTGTCTCGATTCGCCAACTTGACGACCTGACCGACTTGGACTGCGGACCATGGAACCGTCACG
AGTTGGCCGTTGTACACGACGCGGCACTTGGCTGAATTGGCCTCGTCGTCAGCCTGATGCCGCCGTCGGTCTTCAATGATGGCGAGTGTGCCATCCACTG
CCAGAATGAACAGGAGCACGGGCAACGTCGATGGCCTACACGGCGTCGTGTGGATTCAAAATCGCGCAAAGACACGTACCACCCGGTGTTGGTGATCGCT
GGAATGCACTGAAGGACAGACACAAGCAAGAAATACGCGTTCGCGAGCTTGGCGAAGCTCTCAACTGTGAACTTGGGGATGAACGTCCACATGGTATACT
TGGACGTGACGACAACGTTCGTGCAAAACGGTCCGTGCGACTCGGTCGGTGTCGGGTTGAGCCATAGCTGGCGAAAC