Description :
From Genome Similarity Track
Location :
Scaffold_97:4031- 6867
Sequence
2836 bases(100 bases per row)
ATACTACCTTGAAGTCACCTTTCTTTCTCCTGCCAAACCTCTTGGTACGCTCCATGACAATAACATATCCCTGTGACGTTGCATATGCCTTTAAATTAGC
TTGAGCCTATGCAAGAGAAGCATTTGCCGGTCTCAGTAGAGTGTAAGGGCAGTTAATTTTAAGGAGTTGTGGGAAAAGAAAAGTTGCAAGTGGAAGGTGT
GTATTCGTATGTGCCTGTTGTTGGTGGAAAAGTGTTCATTTTCATTCCTTGTCTGACCAATCAAAGATTAAAATTCTCGTTACACTTCGTTTTACTGACC
AATCAGAGTATCGTAAGTGGGAGGGGGTAAATAGTTATTGCGAGGGGGTGGATGCTCAACCCCTCTCTAAATTATTCGCTTTCTATTGTTGCTAGCCTGA
AGGGTGAAGCTATTAGTGACTGTGCGCAAGGTGAATCCGAACTTTATTATCGTACGTATCAGTGTGTGTGTTCGTCGGTCTGTCTGTATGTCTGTAAATA
ACCCGGCTAGGTGTACCGTACACGTGCTGAGTGCGATCTATCCTGCCCCCTCCTCATATGTATATAAGTATATAAAAGTCACTCTTTGGCTAGGTCACTA
TTATACACGCACCCGATTGGCTTAAAATCGATCAAAGTTGATCGATTTAAAGCTGAAAATGATCACATCAGCAAATGCTGGACGCTTATAAGCAAGGCCG
ATCGCGTTGCCCTACCATACTGTGCTGCGTTAATACAGACATTAACAGCATAAAACATACTCGTTCTTCAGTAACTACTGTTTGTGTAGTGTTTTGCAAC
TTGATTCAGTTCTCCGGACAGAATTAATTATATCAAAGGGCGAGCTCCAGATCTTGCTCCCCTATTTTATTCAATTAATTTTAGGGAATTGATTGCGAGC
CCGAAGAGTGAAGCTATTAGTGAGTGAGCGCAAGGTGAATGCCGATCTTTTTAGATTGTACTTGTTTGTCTGTGTGTATGTGTCTGTAAATAACGCTTGG
AGTGCCATAAACGTCGTACTAAGTCCTATTTAGTCTCTTAACTCCTGTGCATGTGAATAAGGCCAGGTGTACCTTACACGTCGCACTAAGTGCGATGTAG
TGTGTCCATGAGCAACGCTAGATATACCTTTAACGTCGCACTAGGTGCGATGCAGTGGGTCTGTGAGCAACGCTAGATGTACCTTACATGTCGTAAAAAG
TGCGATTTAGCCTGCCCCCTCCTTTGTATGCATCTGTAAATAAACGCTAGGTGTACCTTCCACGTCGTACTAGGTGCGATATAGCCTGTCGCCTCGTTTG
CATGTGTCTGCACATAAACGCCTGTTGTACCTTTCACGTCGGTCTAAGTGCGATGTAGCATTCATCGCATCTTCATTATAAATAGGCATTATAGCAAGCC
CGAAGGGTGAACCTATTAGTGATTGAGCGCAAGGTACGTGTATATACCGAACTTGAGTCAGGGTTCCATGGACTGAACTACTTATATCAAAAAGCGATTC
CCATAGCTTGCCCCTATCGGATGTTGAATTTTCTTTTTTGTACTAATTACGCACGCGATAGACATAACTCGATCCTGAGCTATTTACTTAACAGGGACAT
TACAAAATTGATGTTTTTGTTGTGGCTACAATCTGGTCGTTTGTAGTAGGAAGGTCCACACAAAATACCCTTGATTATCATGTTGGTTTGTAGGAGACAT
GATGCACTTCGTCGGTAGGCCATTCTGAATTTATAAAAAAAGTCTTTTACTAACTAATATAATATCTAAACGACTTTCTGATAAATAGGGAATTGCTGGA
ATATATAGATTTTATTTTCTGTTTTTAGATAATTGTGTAATTTACTTTTTCATAAAGAAATATGTAATACTATATTTATTAGGCTATTTAAGGCTATTCT
AAAAAATGTTAGATATTTAGAAGACATAAACAATTTTTTAGAAAATTCAACTTTACCAACAAATGTTGGTCATATTACTGCCCATAATTTAAAAAATGTT
ATTTTCACATGAATCTTAAAAATAAGTTTAAGATATATAAGTAATTTTTATTAGGATTTATTGGAAAAATTATTAACACATTTGTACTTAAATTAACTAA
ATAGCATAGTGTTCGCATGGTCGCATCTTATAATCCTGCCCGCGTTCTCATATTTCACCCTTTTGCCTACAGATTGAATTCGTAACAACTAAAGATAATA
CGTATTAAGCTTGTAACGGGGCACCAATCGCTTGTACAGTACACGATGATTACTCTGAACCCAGGGTAAGCTGGTGCCTCGTAATCTCACGTACACGTAC
GTGCAAAGCAAGGTTTTAATACGAGATAAGGGTAAATGTAGAACTATATTCAATATAGTTAATGTCCTGTTCATCAATCCTATTTAGTCTTCTTTTAACT
ATAATGCTATACAATTCTAGCTATCAGCTCACCACTCGTTGCGTTTTCTGCCGTGGCTCGGCTTAATTGGTTATACCATTGTCTTATATTGACCAAAGAA
CTGTGAATGGCTTCTGCATCACAATATCACCTATTAAAAATACTGTAAGAATATGATGTCTTTATTAGACATACTATTCAAACTTGATATTTTCCTTTTG
TAAAATACTATGTAACGGACTAACCCCGTATTATAACCCCCCCCGCCGCTTGGCCATCAGTCACATTTTATTTACTGATTGATGATTGAGCGACTACGTT
GAGTGACCCTGCGACAGGGACGCATTTGTTCGCCCATTCCATCCATTCACTGATCTCATCGCATGGTTAACAAGTCCATGTAATACGAGGCCAGAGCTGC
CGGGAGTGCTGCAATGAGACTCCGTTCCGCAACCGC