Description :
From Genome Similarity Track
Location :
contig_3:403026- 404696
Transcript NameFunction/comments
g838.t1Amino Acid/Auxin Permease (AAAP) Family

Sequence
1670 bases(100 bases per row)
TCCAAACCAAGCGGGGCGAGCCTATTCGTTGGCCGTGCTGCGTGCTGGACAAGAGCGCAGCCACGGCAAGTGTCTCGGTTCCGATGCCCACCTTGGTGGG
CATGCAGCGGACCTCCTGTAGCTCCAGCAGTTCACTTTGAAATTGGCTGCTGACGACGCAGTCCGCAAGTCCCCGCCAACCTCGCAGCAGCATCGACCGC
GACACCATGGCCAAACAGCCCTTCTTCACGTTCGAGGACGCTAAGTTCTCCTTCAGCCTCTTTTGCTGCATGTGCGGCGTCGGCACGCTGAGTATGCCGG
CCAACTTCGCGCGTGCGGGCCCGATCCTCGGATTCTTCGCCACCGTGTTCATGGCACTCGCCAACATCTACGCATCCGTCGCAATGTCCAAGGTGCTTCT
GCTCGCTCCCAACTCGGTCAACACCTTCAGCGACCTCGGTGAATGGTGCATGGGCAAGACTGGCCGCTGGCTGTGCGTCATCTCTCAGATGGGTTCCTGC
CTGCTCATGCCGTGCGTCTTCCTTGTGCTCGGCGGCGGTGTACTCGACGGACTCTTTCCCGATGCTTGGAGCACTACGACCTGGATCATCCTCATGACCA
TCACAGTGCTGCCGCTGGCTTTGGTGCCGACCCTGAAGGAAGGTGCTGGTGCGCTTTCGCCGGCTGCATGGGTACGCTGATTGCCGACTCTATCGGCATT
GCAATCGTGGCCCACGGCATGAGTGACCATCCGTCCGTGCCGTCGCCCGAGTTCAGCCTGTCCCAGGTCGCCGGTGCGTTCGGCAGTCTAGCCATGGGCT
TCGGTGCTGGCATTGTCCTTTCGGACGTGCAGCGTCAGCACAGTGACCCGAGCCGCATGCCTCGCGTCGTCACCGTCACGATGGTCTTCATCATGTGTCT
GCTGCTGGTCCTCGGTTTCGTGCCGTACTTCTCGGTCGGATGCCAAGTTTCGGGCAACCTGCTGTACGTCATCTACCCGGACGCCACCACCGGCCTCACA
ACACTGGGCTTCGCACCCAAGTGGGGCACCGTCGTGCTGGCTTACATCGCCATGCAGATGCACGTGACCATCGCCTTCTCGGTGCTCATCAACCCAGCCT
TCTACATCGCTGAGCGTATGGTGCTGGGCATGCACAAGAAGCAGTCCGAGGAGATCGAGAACGGCCTCGCCTACCGCGAATCCGGCACGCCTTTGCCTGA
CCTTGCGAAGACGAGCGAAGTCTCTCGCGTGAGCATGACGTCCAGCCGTCGCTCGAGGACGTCGGTTTTTCCTCTTACCGGCGAAATCAACAATGACCAC
GAGCTGGAGGCCGCCGAGTACCGTGGCGCCAACGCGATCAAGTACATCGTGCTTCGTCTCGCCATCATCGTGGTTCTGGTGATTCTGTCTATCATTTTCA
AGGACCACTTCTCGGACTTCGTCGACTTTGTGGGCGCGTCGGCCATCACGGCCAACTGCATTGTCCTGCCAACGGTCTTCTACCTCATCAAGACGTGGGA
GCACGTCCCCATGTACGAGAAGTTCGGCGCTGGCGTCGTGATCGTAGTGTGCACTGTTCTCGGTGTCTACTCGACGTACACCGCTGGCAAGCACCTGTTC
TTCCCGTCAGACTCGGACACCCTCTTCCCGTACTGCGACGCCGAGTTCCAGGACACAGTGTACTACAACC