Description :
From Genome Similarity Track
Location :
Scaffold_501:4030- 8684
Sequence
4654 bases(100 bases per row)
CTATAATCTGAAAAGGGTACGTCGATTGCATATTACCAGGTGATCCACTTCGATCCCCCGGCCGTCCTTTTCCCGTTTCACAATCTACACATTCTCCCAC
ATGCTGCTGCACACTTCGGTACAACCCACGCCAATGGAAATTCGCCCTGATCCGTTGATAGGTACGGCATATTCCTTGGTGACCACCCTCCAAACTTGTG
TGGTAGTGGTGCAAGAAGTCTCGCTGTAACTGTTCTGGAACCACCAAACGAGCCAGTTCAGTACGATCTTCAGCTTCGGTGGCCGATCTCGGACAGAAGA
ATAGCAGCCCACTTTGGTCTAATTTATAGTCCGGTGCGATCAGGGTGCACACCTTATCCTCAGCTGCCGAAAATTTAGCTACGTCTCCAACCAGATATAT
CTTCAAACTAGATATCCAGTTTTCTTCGTCTTGTGCTTGCTTAATACGACCAATCCGTATCTGCTGCACAACCTCTTCCTTTAAACCCTGGGCTGACAAC
GTCTTCTCTGGGCTGTTCGAGTGATAGCCGCTAGTTTGATCGCACGATCAACTCGTTCTGGTAGTAGTAATTCGTTTAACCGATTGAGAGTAATCAGGTC
CTGACGCTCTTGATAGGAAACCACAACTGTCCCTTTTTCTTGCCGCAGAGCTTCACTCTCCAATCGATCTGCACTCTGATTCTAGTCCCGCTTCATGTGC
AAGAACTCGTGGGATGGCCACGATCGTAATCTCTCCATAGCCCTATGCCTCAGCAACTGCAGTCCCGGCGATTTACAGTCGATTTCTCCTCGCATTTGAC
GGATCACCAAATTCGAATCTCCGCAGATAATCACCCGTCCCCTTGCCTGATCGGCAAGCAAATCGAAACTAAGGAGCAGCCCTCGGTATTCTGATTCATT
CATGGTTAGATCAGGGGTATACTCGGAAGCAACAGCCACAATCGTCCATTTCGGCACTTTTCCATGTACTCGCGCTGTATGCTCCGTCCTTTCTTTTCAC
CCTGGCTGATCCATCGAAACTGGCTACCAGCATGTTTTCATTCACACCTACTGTGGGTGGTGACATGCTTATCGTCTGTCTTGGCTGCTTCCTCGGGGCG
ATCGCAATCAATACTTCATCTACTTCTTCACGAGGTGTTATACTTGCCGCAAGCATGCCGAGTATTTCATCTTCTCCCTTCTCAAATCGCCTAATTTCCA
ACGTCCAGTTCGATAGTAAAGCAGCTCATCTTCCCAATCTTTCGTTGTGGCTTGAAGATTGTAGTAACCATGCTAGTGTCTAATATCGCGTAAGCACCGT
AATCTCACGGGATACTAGCATAGTATAGCAGATGTCTAGCATCCGGAGGAGAGCCAACACTTCTTTCTCCACCGCCCCGTAGTTGACTTCGTTGGGCCTT
AGCATACGACTAGAGAAAGTGACAGGCCAATACACACTATCATATTCTTGAAGCAGAGCAGCTGATACAGCCCACTTACTAGCATACACCACGATTACAG
GCGATCGATCGGGATCGAAATGCTTTAAGATTGGAGTTGTGGCTATCTTAGTCTTTAGCAACGTGAATGCAATCATTGCCTTCTCCCATCGATTCCTGCC
CTCCGGATCGCGATCGTCCCCTGCAATTGGGTATAGATCGACATTGATCTCCGGTTTTGGGTACAGATCACGATCGCCCCCTGCACTCCTTTCGTGAATA
GCATCCGGTCTTACAGCAGAGGTCGGTTTTGGAGCTTCACTCACGCGGTTGATCTCATGGAAATCTGCTTCACGCAGTTTGTACAACACTGATGCGTAAA
CTGCGAAGTCTTCAATGAATCTACTGTAATAGTTGAGACTTCCCAAAAATGACTGCATCGCTGGCAGCGTCCGAGGGAACGGGATGTTCACCAACGATCC
CAGATCGTTCCGGTTAGCTTCCAAACTAGCGAGCGATATTTGATGTCCCAGATATTCAACCCTGCAACGTCCTCAAAAACGTTTGGCCAAACTGATCGAC
AAATTCCACTTATCGCACACCTCCAATAATCTCTCCGCTTTCTCATACAGGGCCTTCCACAACGTAGCTGGTATTAAAATGTCATCAATACAAGATCTTC
GACCCAACACTGATGGTTTTGGATCAGTATCTGGTTCACCATCAGTGAAGACATTGATCAACTTCGGCGATTCCGCCGTGGTCGATTCGGATTTTACGCC
GATTTTCAAATACCCATACAGAGCGTTATCGATCAAACGTTGGTAGATCTGTGGAGCATTTTTCAACCCGAAAGGCATCCGCAACCACTCTAACAACCCT
GATGGTGTGATAAAGGCGGAAATCGCCCTTGCTCTTTCCGTCAACTCCACCACCCAAAAACCACTCGCCATGTCCAGAGAGCAGTACCACATAGCTTTAT
CCATGTCTTGCAATAGTTCGCTGATCAGTGACATCGGATACACCATCAACCTAGTCAGCTGGTCACCCGCCCGTATTCAATACACAGCCTTATGTCTTCT
CCGTTTTTCTTGATGATCACCACTATGGGGGACACCCATGGTGATGTAGACGGTCGAATGATCTTGTCCGACAGTAATCCCTTGATCAGATCGGCGAGTT
TTTCTCGGAACTTTGGTGCTACAGGTCGGACCCGTTGTGCGATCGGGTTAGCTCCTCCCACGTCGACGTCACAAACTGCCCCACGCGCCGCAGGAGGTAG
GGCGTTACCCTTTCCAATAAGTAGATGCCGGCTCTTCCAAATCGTTTGGCGCAACTTCTCTTGATCCTCGGTTCTTGGGGTGCCGGGATCGCCTACTTGA
ATATCATCAATCATTATTTCTTGTGTGGGCGTACCCACTTCGGGAAGAACTACCATGTGCTGATCCACATCTTCCGCGAACAACTCGCCACCATCATGTA
ATACATCGGTGTTGACGCTAACTCATCTCTCGTCGTTTCTTCGTCGATCTTGGTATTGCCCACTTTTTTCGTCCGTCGATCGGCCTGGTCTTGTAACTCA
CAATCTTTGCTCTTAATCCCGTAAGGCTGATGGCTGGACTTTTTATGGACTGGATCAGTTCTTCATACCCGTTATCCTCAATTTCGCTCGATTCGTATCC
CGTCTGTTTCGGTTGATCTCTAACTCGATCACTCTGATCCCTGGTTCCGATCGCATCGATCACCATTGGAGGTCTCACGGTCTTCTCCTCTTCCGCAGGT
GTGTCGATCTTCACCACTTCGTAGTCCTCGACCAGTCGATCGGCCTGTTCCTGAAACTCACCATCTTCAATTGCGATCGCGGTCTGACTGATGGCTGGAC
CGTTTGTGAAACGGATCAGCTGCCCCATGTCGGATCTCTTCCGTCGCAATCACCTTCACGCCTTCGATCGCTTCACTGGGCTGATCTCGTCCTCGATTGG
CTTCTACGGTCCCTTTGATTGTGTAGATCACAGAAGGTATTTCTGTTGATCGTTGATCCTTTCTCGTCAAGTGACTTCCGTCCATGGTTTGGTCTTGACT
CTCGCTCCCGTTGGTCGTTTCTTGGTCTGGTTGCGACATGCGCTTCCCCGATATTTCTGTCGTTTGGCGGGGTAGAATTCGAGTGGGCCTTTCATACACA
GGATGATCCACCAACTGCCCTGCATACTCTTCCACTGTCTCTTCCTCACGTTCCGTAGTCACTTCAAACGCTAGCGTTTTCCATTCTGTATCGCCGTGAC
CCGATCGATACATACCCTGGTGATCTAGGTATCATGTCCGATGTCATCCACAAAGCCAACGAAGCTCCATGATTTAAAATTATTTCACGATCGCTGAGGT
TCGTGAGCTGCAAATACTTGATCTGATCGGGCCCATTAGTCACTGTCGGCACCCACGCCACGTCTCGCTTCAACCCAAAGCTTAGCTTTAGGTGGGCCAA
CCCCAATACGTACTTCTGTCGATCTGCCAACCGTTATGTCCACATGTTGATTATTCAGGTTGATCGCCTGCATGGTCGATCGATTAGGTGGCTTCCGTCC
TGCCAAACTAATACGCACCTCTTCAGGTAGACATAATGTTCTGTCGGCTAATTACAAACGGATGCCCGCCGGAACCATAGAATTTATACCCAATATGAAT
TCTTAGCCGACCTGACCACCAACCCAAACGTCGAAATAATAAACCAACGATCCATCCAAAGTGATCTTGATCTTCGTCCGTCCCACCGTCATATACGTGT
TCTCTCCAATTCCGACGCACTCTTGTGTTTGACTGTCGTCGATCACACATCCTACCTTACGAGCAAAGGTAGTATCGAGGATCGACATTTCAGCGCCGGA
ATCGAACAGCATCGTGGCTTTCTCATTGTTGATCTTGCCAACCGCTTTTGCTTGCTTGAACCATTTCCGGGGGTGTGGTATTTCCAATACCCGCGCAATT
TCCCTGTCGCGAGGTCGTGCTCCATCCTCACAGGCGATCGGGCGTAATCATCCACTCTTTTCTCACTTGATATCGACGAGACCAGTGTAAAATCTATATG
TAGATTAGCGATTGGATCGAACCGGTCGTTAACCTCTTGATCTCTTCGTGGTCCTTCCACAAATGCATAAATGAAAAGCCTAGAACGCTCGGCTCGTGCC
AGATTCCAACCTGGCGAGCGTTCTAGTTTAACATCTCCTCCACCCTGGGCGGAA