Description :
From Genome Similarity Track
Location :
Scaffold_506:403- 1809
Transcript NameFunction/comments
Phyra_86170PREDICTED: uncharacterized protein LOC101063318, partial

Sequence
1406 bases(100 bases per row)
CATCACTGCGCATCCGATCGCAAAATCGGATGCATCGCACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCA
TGCTTGACTGCTTCAAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATTTTGCCCGCGTAGT
TGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACGTATGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCC
TGGGTCAGGGCGTACGCCGTTCTTCCCTACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGC
TTTTGCATGAGCTCAAGCAACTAGCGGAGATGCTCTGTATGCATCTCCACATCCGATTTCCCATTCACAGCCCGGCTGTGAATGAACACGTCATCGAAAT
AGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATTACGAGCCACTC
CCAGAGCATGCCGCTCGGAGTGCTTACCGCTGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAG
ATAGTACTCGAGGTCATCGAATCGATGATCACATCATTTCGAGGTATCGGCGTCTGTGCCGGTACCGTCGCGTCGTTCAGCTTGTTGTAAGCATGAACGA
TGCGCCACCCGCCCGGTGGCTTCTTGACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCTTTGCGACGACTTTCAAAGAA
GTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCAATACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTG
TCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGCT
CGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCAGAGATCAGCTGATTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTC
CGAGAGGATGCAGATCTGCTCGATGCGTCCATCGTGCAGGTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTC
GGAGGATTATCCAGCCTCATCTTCTTGTATTGGAGACCAATACTCGTACGCGTCAAGACACTCAATGTCTCGACGGTCGTCTCCAACTCCTGTGTCTGCC
CGGCAG