Description :
From Genome Similarity Track
Location :
Scaffold_3016:403- 1767
Transcript NameFunction/comments
Phypl_g15560hypothetical protein

Sequence
1364 bases(100 bases per row)
CCGCAAGATGCtgggacaaggcgctggtcctTTTGGGAACCAGTCGCTACGTGTCACCAggtcgccaccttctctcAACTCAAAGATCCCGCCAACAGGA
CGCGACGAGCACGGAAAGGTCACCCCAAGGacacctccacgagctgaTCAAGGTACACCAAGACCCTGATCGACTCTACACAACGGCCGAGTAAAGATTT
CCACGCGGCTGTCACCAACAATTCCCCAAGTACCGTCCACACAAGCTCAACTCAAGATCGCGCCGACATTTTCGCAGTCACCGGAAAAGCGTAACCTGCC
CAAccaacgggtacacaagATGAGAAGATTTCAGCCACCACGGACGaacggagtaccccctccgtaaGTTGGCAGTTTGGGCAACAGTCGGCTAGCTTGG
ATCGCATCAGCAATTTCGCGTTTCCTCCTCCGCCACAATGGTGCGGGTGCCCGGATTTTCTGATGACTCTGGATTGCACCGTGAGTccgccgaagaagat
gtcAATATCAAGGTTAAGCCAGGGATTGGTGCGTCGACGGAAGGTGAaccgctgtcgtcgctgctgaaaaACGAAGGATACACCGATAGTTGGAGCCCTG
GGCGGAGTTCCGACAACGTAAAGGAGGAAGGTTCAGCGATGGacctcgaggagaagcctccatctcctcccCATGTCCCTTCGGGGACCCCCGCGGGTCG
CGCGAATGATGGAGATTCATCGGTGAAAACCGAGGGATCTCCATCTACCACCACTCCTCCGGCCTCGCGCCCGaccttgaagaagaagaccccGCGCATG
AAGCTGAGGGCCCCCGAGTCCGACGCGGAAGATCGCAGTGTGCTTGAGAGCTGGACCGACGATCAGTTTGAAGCACGCTTCTTCCGAAAGGGactgtacg
cgctgctgatcgaGGATCCAGTTTGGAAGATCATGCGGCTGAAGCTGATCGGTGATCTTTGAGGACCCGTAACCGCGCCCAGGGAAGTGCTGTACACGCT
AGACACGGTGAAATACCTGAAGCGCATTCTGGAGGAAGCTGCGATCGTGCCGAGAGCGTTCGACGCGAACTTGTGTTTGATCTGGAACTGACCGCGACCA
CGAAGGCGATGCTCGCTCTCTTCGAGAATGCTGGCTGCTCTGGTTGGAGTGGCCACGCTGGTTGCAACGATACTAACACCGCGCAGCGGTTCATCGCAGT
ACGCGTCAGCTACGTCGGATGCGGGGTCAGACAGTTCAATTGAGGAGAAGAGGATGACGCTGGGACCAGCTGGCGCCACCATGCTGGACGTTCGGTAGAA
GGAGGCGAAACTGGCCTTGCCACTGGCCGCGCCATTAACCTCCGGGACGTTAGCTACGGACCCG