Description :
From Genome Similarity Track
Location :
Scaffold_59:403- 13117
Transcript NameFunction/comments
Phyag_g1355hypothetical protein PHYSODRAFT_561927
Phyag_g1356hypothetical protein PHYSODRAFT_354944
Phyag_g1357NADH dehydrogenase
Phyag_g1358hypothetical protein
Phyag_g1359hypothetical protein
Phyag_g1360hypothetical protein PHYSODRAFT_346938
Phyag_g1361conserved hypothetical protein
Phyag_g1362hypothetical protein PHYSODRAFT_302895
Phyag_g1363hypothetical protein PHYSODRAFT_511418

Sequence
12714 bases(100 bases per row)
GTGTACATTGGACCCATTGAAGGCCTCGCAGGCGACGATTGGCTGGGTGTGCGGCTGGACAAACCTTTGGGCAAAGGGGACGGCTCGTTCCAAGGCAAAC
GCTATTTCGACTGCAAGCCGCTGCATGGCGCCATTGTGAGGCCAGAGAGGGTCAATACGAAGGGCGAGTTCCCAGTACTGACGACGCACGAGGAGAGTCT
GGCTCatgcgctggaggagcgacgcaaggagaagcaggaggcgagTAGAGCGACCAACGGTGATGCTGACGCGTCGAAGCTGCACCGGGAACTGACGACT
GATGAATTAGCGACGACGTTCTGGGCGAAATTCACGCAGCAAGAGGACCAGGTGCGCAAGCAGGTGGGGCTGTTCTgtgagcagaagaagcagccgcTGC
CCTGTGAATCGGCCAAGGAGGTCAAGCTGGATGCACTGGTGCTTGAGGTGAACGCCATgcgagacgctgcggctACGGCATCCTCACTGTTCTTGTCTCC
GTACGATACGCGGCAAACTCAGTTGATTCTGTCCAAATTGCTGGAGCTGATTGATAGTACACGGGCGACATTTGCTCCCAGGAAAAAGTTCACGTTCCGA
GCTCATGCGGCGAGGAAAGCTAAAGCCAAGGCGGCAGAACAGCAGGACCAACCGGAGCAGGGCGGGTCGTCTGCATCGGATGACGCTACAGGCAATCTGA
TGCTCGATTTTACTGCGCAAAAGGCGTTGGAGTTTGACGAACTGGTACACGCCAACAAACAGAACGAGGTGATTGTCATCGATAGTAGCAGCTTCGCCGA
TGCAGACGATAACAAGCGTCGGGACCTGAACTTTTCGCATTTGACCAACTGCGTCGTGCTGGTTTGCGTGGAGACATCGGCTATTCGCGGCGATGCGCTG
AAGAACTGTGTGTTCTACACGGGAGCGATCTTCGGCAGCTTGTGGCTTGAGCACTGCAATGGCTGCGAGTTTTTCGTAGCGTGTCGTCAGCTTCGCGTTC
ACTTGAGTACTGCCACGGCGTTCCACCTCCGCATCCCGAGTCACCCCATTATCGAAGATTGCCAACAGATGCAATTTGGACCTTACCGCTTGCAGTTCGA
TGGCCTCAAGACACAGCTCGAGCGTCTGGGCGCGCCGAAAGACTCAGGTCTATGGGCTAAAGTTAACGACTTCAAGTGGCATAAAGCGCAGCAATCTCCG
AACTGGAGCACCCGTGATCCGAAGCAGCCACTGCCCAAAATCCCTGCTGAACTTGAGAAGCTGGTTTCTTACGAGTGAAACATCATCCAAGCTGTTAGCT
TATTTAAATGACCACAACTTTGCATGGCGCATGCCCACTCGTGGTCAGGTCGAAGCAAGTAAGAGAGATCAAGTGCACTTGAAAGTATATAAACACAGCT
GGACGGTGTCGTCCCTCTATCGTCTCGCCTAATGAGGATTACACCCCTGTCAGTCTAGTCgtgcttgctcttcttgtgctttttcttcttcgcctccttG
TCCTTATGCTTGTGCTTCTTAGGTTTCACCTcgaccacctccacctcaacaggagctgcctcctcctccgtaGGCTTTTCGTGCTTGCGTTTCTTGCttt
ttttctccttcttccccTTTTTGTCCTCTGTTTCCTCCACTTCCGCAGCCTTCTTTTTGgacttcttctccttgatcgGCTTAGTCACCGGCTCTCCTGC
TGCAAGGTTAAGgtgcgtcgccttcttcaccttcttggccgaaGTTGGCTTCACAGCGCTGGTGCCGTCGAAACGCATCGTAGCTTCAATAGCCACCATA
CCACCAGCAACGTGGACACTGCAAAAGAAACAATAACAACGCCAATCAGCTCCATATActactgcagcagctatTTCAATGCAATCTGAACTCACCGCAG
CACTTTCACTTCGACCTCGTGTTCCACCGAGATGGACGATCCATCTTCACCCAACCTGCACAGCAACACGCCAATACCAGCGTCAATAACAACCAATATA
TActtttgcagcaattgtagcagcagcgtacCAGCAGTCCTGTGCGTAGTTGTGCACGTATCCCTTGGGGAGCTCAGCCTCAGCCACGGAGCCGTTGAAG
ACGCCGGCGAAGAGCATACCCACGTGGTTGCTGCCGATTTTGTTGACGACGCCACGCAGCTTCATTCCCTCCTTGGGGCGGAACACCAGAGCGTcggcca
gcaccttgcagTGGATGAATGGCATCTCGTTCACGATGACACCGTAGGGACGTGCCAGCTGCACGTTGCTGAAGCTCAGCACCACCCCCTGAAGCGGATC
CGAGTAGCGCATGAGCTGCTCCGTCAGGTCCTGCTCGATACCCACGCGCGAGTCCATCGCATGGCACGGAGACAGACTCACATTGTGCCGCACCTTGCAC
AGCACGAACGCGTTCGACGCCATTGTTGCTACAATTGTCAAAGTGCTGTCGCTTCCAGTGAAAGCTCAAAATtattttcaaccaatcaaCGCTAGCTCCG
TTAAAGTGCACCATTAATCGCCACTAAAGTTGCGGCTGAGTTGCGTTAGTGGTCAGAGGTCGAGAGCCGcccgtcgagcagcagctccccACACTACCGG
AACGCGAAGTGATGAACGTCGTAATGCTGCGTCGATCGGCCGCGGCTGTGGCTGCCAAGCAGAGTCTGAGTCGCACGGCTCCGGCCGCGATTGCCGGCAG
CGCCCGCGGGTTCGCAAATGTGCCCGCGCCCGGCAAGCTGGACCCCAAGCCGACGTGGGGCGAGGTGATCGAGAAGATGTCGGACACTTTCTTCCTCTCG
GACGTGTTCCGCGCCACGTGGCTGGCCTGGGAGGTGCACGTGGAGCGCAAGGTCACCATCAACTACCCGTATGAGAAGGGCATGCTCAGCCCGCGCTTCC
GTGGCGAGCACGCGCTGCGTCGCTACCCGAGCGGCGAGGAGCGGTGAGTGGTcattctggtggtgcagtcgGAGGAAGAGTCGCATCTCTCatgcgttgc
tgttgttgctacTATTAGGTGCATTGCTTGCAAGCTCTGTGAAGCTATTTGCCCTGCGCAGGCCATTACCATTGAGGCGGtacgtgaagaagacaacAGT
GTTAAACGGatcttcgacaagaagctgaccaattggtggtggtgtatTGTTTTATTTTCTGCAGGAGCCGCGTGCGGACGGTGCGCGTCGTACGACTCGT
TACGACATCGACATGACCAAGTGCATCTACTGCGGCTTCTGCCAGGAGGCGTGCCCTGTggacgccatcgtcgagGGCCCGAACTTCGAGTTCGCCACCG
AGAGccacgaggagctgctgtacgacaaggccaagctgctggccaacgGTGACAAGTGGGAGTTCGAGATTGCCAAGAACCTCtcggtcgagcagctctA
CCGTTAAGCAGACACAACACACAGATAAAGAAGGAAACCGTCCAACGCTGTGAGCTGTGACATCGGTCCTCGGCGGAAGTAGATCGAAGCGGCGGACTAA
TGCAGGTTTGTAGCATCAACCGCGCCTGTATTGCTTTCACTGGGGTGACGAGTGGGGTGCCTTTATAACTGAGAAAATAAGAGCGAAGTTTGAGGCTCTT
CAAGGAGCTTGCCAGGGCAGTATCAGACAATGGCAACCACCTCGACAGCCAGGTGCAACACGAACGCTAATTAGCTATCTATACAGGGGGCGGTATTGAA
GTTATGAAGGCAATCAGCCTAATCGTCCTCCGGCGGTGCGATCGTAaacttgatcttcttgatggtCTGCCCAGCGAATCGGTACTTCTTGTCAGGCGAT
CTCGACGTATCCGTGTCATAGAAGTAGTTCGTCCCTAcagtctcctccagctgaCCGTGCAGCTCGTACTCTCCGATTTTCAGCATTGGAGTCATCGTGT
CAATGCCCTAAGTCGaagccaagcagcacaaccGTTAAACCACCTGAAGCACGAACGGTCAAACATTTCGCAATCTCACCTCTAGCGTCGCAGAGCTGTA
GTCGTCGAACAGCGGGTGATTCTTGAAATCGCAGAGCTCCAGCACTACCagagcctcctcctcctcttcttctccttcattctcttctccaccgctggCA
CCTTTTCCATTGACTGCTACCGGCGCTGGAGCCTTTTCCTCCAATTCATCCGCTACCTCGTTGCCATTCACGTGATTCTCGCTCGTTCGCGTTGCAACCT
GCACGCcgttcatcttcgtctcTTCGTCCAGATCTCCACCACTTCGCATCGGCCTCCGTCGCTTCCCCGTGGCAGTAGGCGAGCTcgcagcaccacgacc
agCGCCGCCCATCGCAGCCCAATTATGTTCAAAAATCACGAAAGCGAGGTTAACCTATTAAACCGATAGAATTAACCTCTCACAAAAGTCTCGGCGACGT
CCGTGACCAGCCAAAAGCTAATTGGCAGTTGACTTGACTTGAGCTGCATCATGGCCATGGCTCTGGGCGATAACGCGaccgtggtgctgtcggGTATTGG
CACGGAGCTGTCCGATGGCATGCTCATGAACATGTATCGCACCTACGGCCCCATCGTTCGCGTCCGACACAACGGAACCAACTCAGCGTAAGTTGTTGAC
ACAGTCTTCCTCCTGTGTGCAATGCAATTGAACTGATGCATGCGATCGTATTTTGTAGTCATGTGgtgttcgagcagaagaaccACGCGTTGAAGGCTGT
GGAGGCGACGAACGGCGCGGTGGTGTacggcaagacgctcaaggtctcgctgcagcgccagttCAAGACCACGGAGCCGTGCCGCGGCTTCGCTGCTGGA
ATCTGCCGCAAGGGCGACATGTGCAAGTACGTCAAGTAGATCTTGGCTATTGGTGTGGGGTAAATGGAGGCTAACTATCTTGGTGCAGATACTACCACGT
GACAGACAATGCCGCgtttgcagctgctgctcctgttgttgAAAAGGCCCCTcgtgagaagaagaaaaagacaCCGAAGGTTGCTAAGCCGAAGATAGAG
GCGCCGACGCTTACTGAGCCGATTGTTATCACGCCGGAGATCCAATCGATCCCGGACAAGCAGGTTTGCCGTCATTTCTCGCGTGGATACTGCTCGCAAG
GCATGGCATGCAAATTTGCACACGTGCTGGGAGGCCCAAAGCCGGCTGCGCTGACGGGGAAAGTTGCGCAGCTTTGCCAGTTCTTCCAGAGCGGAGTGTG
CACTCGTGGTGAAGAGTGCAGATTTATTCACCAACCCAGAGCAGGTGCTGAGCCAGTCACGTCTTCTACGACCAAGGCTTCTGCAACTAAGGATTCTGAG
GCCAAACCTTCTGCGACCAAACCTTCTAAGACCAAGGCTGAAGTCGAAAGCAGCAGTGATGAGGAGAGCGAGGCGGAACCCGAACAAAACAAGGAGAACC
GCACCTGTGCCGAGTGCGAGAAACCTGGTGTGGCCGTGTGGGAGTGCGTAAAGTGCGATAACTCGCTCTACTGTGACGACTGCAATTCAGCTGTACATCG
TGCTCGCGTGATGGCCAAACACAAGCGCGCAAAGCTCCCTCCAGTACGCAAACTGTTAAAGTGTGGTGAGTGCGAATCAAAGACTGCAAGTGTCCGTTGC
GAGCAGTGCGAGACTCCGTTCTGTGCCTCATGTGATGCTAGTGTGCACAAGTTCAAGAGCCTACGGAAACACACTCGTGTTAAACTGTCGAacaaggccg
agaaggcAACGCCGAAAGTTAAggagcccaagaagaaagagtCCAAAGCtacgaagaaggaggaaggaaAGAAAAACAAAGGCCGAGTTGCGGAGGTTGC
ACCTCAACCCAAGGTGGTGAAGCCTGTGCCATACGTCGAAAGCGTACCCCAGCTCGAGTTTTCAAGTGATTCCGAGTCGTCCGAGtcagaagatgaagag
atggaggaagCCTCACCCATCACTTCTTCGTCTACgggtgatgacgatgaaccAATGCCCGCTGCGGACGAGTCTTCAGAAACGGAGTCGGAAGAGGACT
TCGATGATGTTAAGCAGTCTTCTTCGGGCTCTGTTACTCCCACACCTGCTGCCAAGAAACAAACCTCTGAGTCGTCAGAGTCCGAGTCTGAAAGCGATTT
CGAGGATAAGCCAACGTCGAAgtcaacgccgccacctGCATCTGTACCGAAGATGGAGTTGTCTTCGGATTCGGACAGctcggacgatgaagaagacacg
gaGCGAACCCCGGCCCCTGCTCCAGTGCCCAAGACAACGCCTACTCTGGCAGAACTCTCTTCCGAGTCTGAAAGCGATTCCGACGATAAAGCTCCATCCA
AGCCTGTCGtgaagcagacgaagaagccaGAACCGAAGGCTGCTTCACCAGAATCGTCTTCTGAGACTTCTGGTAACTCCGATGACTCCGATGACtccga
tgaagatgaagctccaTCCAAGCCGGCCGCAACAACAAAGGTGACACCTGCTCCCAAGGTCGTCGTAAAGAAAGCagcttcgtcatcgtcatcctcgaGT
TCAGAATCTTCAGACTCTTCCGACGATGAAACTCCTCCAGCTAAGCCGactcctgctcctcgtcgtgctcCAGCCCCAGCTCGCAATAACAAGGCAGGAG
GAATTTCGGAGGGCAGCTCACACACTCTTGTGAAGAAGATTGAGGCTTTCAACGAGTCGGGCGATGACGTTGAACTACATTTGGATGCCAACCTGAATGG
CTTCGAGCGATTGCTGGCGCACGATTGTGCCGAACGCCTTGGTCTTGCGCACGAGAGCACTGGCTCCGGTCTCGAGCGTCATATCATTATCTCGCGCCAC
GGAGCGAagcgtcctgcagcagattccagcagcggccgcaaggcgaagaagagcaaacaCCACTAAGTAAGGTCAAGACGCAGCTAGCCTAGCGACAAAA
CACCGAACAGCCATAATAGattcctcttcttctccgtgtTCATCTCTCGCGCCTGAAAGGCTCACGTTCGTATCTCACAGTTCCAAAAGCCTTCGAAAGG
CTTGCTTTGCAACAGATCCACCGCTCCGGAGTGTGTCCAATTCCTGTCCAATTCCTGTTCTAACCTGTCCGATTGTCCGATATCCACGACCAGGATCCAT
CGAGTGCCCTAAACGACTGCATTGCAATCCGCCCCAGGCTTACTTGCGTGCGGCTCTTCTGTCGGCACGAGTAGCGGCGTGGAAACCCGAGCGAATAGCA
GCCACAGACCGCGAGGACCCGCAGTCCTGGCAGTGCACGAAGTAGAGGCGACTGACTGAGTCGCGCGTGAGCGTCGTGTTGGGCGAGCGGCACATCTGGC
ACGACACGTACTCGGTGATgtacttgcgcagcagcgactcgatgTACTTGGGCACGTATCGGCCGCGGATGACCAGCCGCTGGTTGCCGTCGATGGATCC
CTCCGTGCCCAGCTCGGCCAGcgtgaactgcagcacgtgctcgGGGCTACGGTGCATCATCTGGCAGATCTCCTGGAAGTTCACccacagcgtcttcttg
gtgcccACGCGCATGAGCTGCGGCGGCTTCATCGTGTGGCGCTTGCGGTCCGTCAGCTCCGGGTTGTTTtcgtgcagcttggccatgatgcgggccagca
gctcgtccttgtaCGAGTACGTGGCCGGgtcctgcaccagcaccgagtTGGCGTCGGGCGCGGCGTCATCGGCGGCCTCGgcgtcctccgtcttctcctt
cttctgctcaTTGGTCGTAAATCCATTAGTGAATAAtaaaaataataaaaaaaaagatATTATAAAGCAGCcgcacctccttcttgaccttcttggattt
cttcttcttcttcttcaggtcgaACATGGCGGCCACGTCCTCAGGCACGGCGGGCGGGGCCACGGCGGCATCGCCCGCGGGCGGCAGTTCCTGCTTCTCG
GCGACGTCAGCCATCGTTGCTCTGGTCTTGGTATTCTCCCCTTGGCTGGTTACCGTGGCTTCTTGCCTACTTCCCTCGAGTTTTCTGGTGGCTGCGCGGT
TGTGGCCACTCTATACGAATAtatgattggctgaaatacAAAAACATATGATTCGTTCAAATCATACGCTATTTTGACCAATAGATgatcggagctgctg
gtgcctcACACTGCGAAGCTACTTGTGGACAGCAgagcgcgtgcagctgaagatggcgaccCGTATCCCGATCGCGTTCCGCCGCGGCCcgcgcaccaag
aagaaagcgatCGACCTCATCAAGACCTGGCACATTTTCCGTGGCGACAAGGTGCGCAATTCTCGTCGCTTAACTCGCAGTATTCGTGGAGATATCCCGT
TGTTGACTGTTTGTGTCATTTTGATGCGAATGACAGGTCGAGATCATCGCTGGACCGCACAAGGGCACGCAGGGCGAAGTCGTGAGCGTCGTGCGCGACC
TCAACAAGGTCATCGTGGAGAATGTCAACATGGTGCGTGCTGCGTACTCACTCCTATCATGCTCTAGGCATTAATTACAGCTGACCTTTTTGCTCCTCTA
TCGTCTGCAGTCCCACCGCTACGTCAAGTCGACGCCTGCCGCTGCGGGTCGATCGTACCTGTCGCCGTCTCCTATCCACTATAGCAACGTGAACCTGGTG
GATCCGTCCATCGGCAAGCCCACGCGCGTCGCCATCCGCTACACGGACGAGGGCGAGAAGGTTCGCGTGTCCAAGAAGACGGGCACCATCATCCCCAAGC
CTGCCATCCTCAAGGAGCGTCACAACCCTCGACGGACAGGTTCGTAGTATTCTTTCGCTCCGACGCTGTGGTTGTACCGTAGCTGACAGTAtcgttgtcg
ttggtgtGTTTTTCTGTCAGAAACGGGCCCCTTCGACACGGCACCCGAGGATGTACTGGAGCGCACGGTGGAGGACTGGGAGGTCACTCGTCTGTAAGCG
CCGCTCAGCTCAAATCCGCTGCGAGGACGATAGTGAGTGCCGTTGTAGACCCCGAGGATGGCGGCTTACTATATTCAGCTCCAATACAGCTTCGATGCAG
GTTGTGGTCGCGATTGCGCTCAAGATAATGATAGACACCGATGACCACGCTCGCTTAATTTCCGTTTGCCAAATGCAGTCGTGCAACAACCGCTGTCTGA
CTCGATTTGGCGTGCGTGGCAGGTGTGCTCAGAACGCTGAGGCTGTATCGAGGCTTTGCGGCACAACCACACGAGCACGTATGCTGTTGTTCATTCTTGC
ATTCGTCACGTAGAGCTTAGTCGCGCTTATctctcagcagcagtaccaacGCAACCATGTCCCTGCACGAAATTGAAGAGTCCCAGCCCCTGTCAGTCGA
TGATCAGCCGTTCTACGATGCCGTGAAAGCCGAGTTTGGAGACCAGTGCACCGAAGATCTGGTGATCCGCGTAGCCCGAGCGTATCGcggcgtgaagaag
aaccgtGAGCAATTCACGATTTCGGAGACCAAGAAAATCCTGGATGCGCGAGCAGcccacgacgtcgacaaTGTCCTGGATCGCGACTTGCCCATGTCCA
AGCTATACAACGAGTACTGGCCGACCTACATTTACGGTGAAGATCAAGACGGCCACCTTGTCACTGTGGACCGCCTCAGCGATATTAACACGGATGGGCT
ATTCAAGACTTTCGTGAACATCAACGACATCATCCCGCACCGGTGGCAGTACATGGAACGCATTCAATGGGAGAAAGCTGCCGTCTCCAAGCGACTTGGT
CGACGTGTCTACAAACATGTATGCATCGTGGATCTGAAGGGCCTCAGCATGAAGCTCCTCGCGCCGTCGGTGTTGAGTCAGCTCAAGGTACGGACACCAT
CAACCGTAAACTGCAGTTGGTTTGAAGCTGATGTCTGTGTTTCTTACTTCTAGCCGATCTTCGATGTGGGTCAGCTCTACTACCCCGAGACGCTGCACTG
CCTGTACGTTGTGAACGCACCGTTCATTTTCTATGGCGCCTGGAAGGTGATTTCGTCGGTCATTCAGCCCGAGACGCGTGAAAAGATTCAAGTGTTTGTA
CGTGCCTTGTTTCGCTTTGCAATGCTGGAGTGTTGTACTGAGTATGTGGCTTGCATTTTGATGCTACGCAGAAGGACATGAAGGCATTCCTGGAGGTGGC
CCAGAATCACGGTATcccgctgtcgtcgctccCCTCATACATGGGCGGATCGCACCCTGGACGAGTCATGAACAACTCTTTCACCGCATCCGAGTCAGAT
ACGCCGTTCCCAGTGCCTGCTGTGACAGcggtgacgatggagaaggaggttcCTGCCGAAGTCGCCGCTGGAATAGAAGTGTGCGCAGGAAATTAGAGAT
GTAGACGCGAAGGAGACTTGCAGCAGCATAATGTATCAACATACACATTTCCATTCAACACAGGTAGCTCTTGCTGAAGTACAAATCGTAGCATCTCAGG
GATGCTGATGTCCGCAGACTCttagctgttgctgttcacggcgtgctggaagctctgTCGAAGAGATCTTGCTGTATCTGCTGGTAGAATGGCAGCATGG
CCCTCCGTTCAATTGGGCCGTTGCTACACTCGACAAAGGCCTGAGCactctggagctgcttggaATTGGCTCCGATTAACAGCGAGCACGCCGAAGCGCT
ACACATCGCCGCCCCACTAAGCTGAAAGGTACTGTCGGCGTCCACATGCATGTGAATAACTCGGGATCCGATCGTAATGtcgccgtcgatgtcgttctcg
tcgtccggTTGGGATTCTTGCACCTCTACAAGGCCACCGTTGCGCATTATTGGCACCACTGATGCAAAGGTCAGTGACCCGAGACTACGGGCGAACTCGT
GTTTGGCCTCTTGCTTTGGCGTCCCAAGTGTCCATTTCACAACACCACCCCAGAGGTGATAGAGCTCGAGGAATGTTTCTTGCGTGACGCTATTCGAGTG
GCACGTTGAACGGCAGGTTTCGAGTTCCGGCATGGTCCAGAGAGGCATCACCAACACGAGAGTACGCATAGTATCTGATGGGTCCTGTGTCGTCACCGAG
TGCGTTGGTGGAGACATCGCAATAGTACGGGCCTGGATTTTAGGATCAATGAATGCAGTATCATCGGTCCAAGTCGCATCGCACAGATACACTGTGGCCC
GACTTGCGAGCTCCTGTCGGAAGCTGGAATCTCGACTGCCTTCAGTGACTTCCCCGCTCGATGCGATGCGGCCGAAGAACCCCGCCATTGTCAGCACAAT
CACCGGAGGCTTCTCCAGTCGACACAAGTGCCGCAGCACCCAACAGAGAAAGCTGGTCTTGCCCGTGCCGGACGACCCGGTGATCACCACCCGATGGTGC
GGCACATCGGGGTGGTCCACGAACGCCATGGCTaagatcagcagcacttggtaTGCTGGACGCACGTACAAGCGCGACGAGGCTGCATCGTTCAGCCAGC
ATACACCCCGAGGAAGCTCGAGCACCGCTGGGTCGACTGAGCCGGGCAGGATTCCGCCGTAGCTGTATAAACGACCGTTCTGGGGCTCCGACGACAAGGG
GATCAGCTCGGATGCTGCTACGGCGGACACGAATTGCTGGACGGTATCCTTGTCCAGCATTGTCGGGACTGATAAGCTGCTGTGTGTTGGTAGTggcaaa
ttggaaagtgaggGATGAAGCAGGACAGCCAACGCAAAGGCTACGAGAAGAGATTGCGATCCAGTGTGGAGGCCATTGCGTTCGGTGAGTCGTGCGTGAG
CGGTCCCTCTGCTATGACTCAAAATGTTTGCATCGGCTGCGTTCAACGCCCGAGAGGCATCTCTCGCCACGTCAAATGCAACTATAGAACGCTCAGCAAT
CGCTATTCCAAATCGCACTGCATTGCCGCGTGGTGccgaacaagaagatccgTACAAGCGAGTCTTGTTTGCCCCAGTTCTGGTTTCTGGCAGCGTAGCG
GAAAATGGACTCGAGAGCTACTCGGCCGATCACGACCACCAAATTTTGTCCAAACGGGGTACAAGGGCTCTACCACCAGCGCAAGATCAGCCCTGGCGAC
AGTCGAGACGCGCTGCAACGTGCAAACGTGTCGACGAGACAAGAATTCACCGTCCAGATGTCTTGAGTAACATGGCACAAGGCCacagcaagctgctgcc
aacaagCCTCGTACTTTCATAGCCAGGATGATGTGAGGCGCGCAAGACCGTCCAGTCTTCATCGCTGTTCCGAAGGAGGATCTCCGCGCCGCTGCATCGA
ACGAGCGCCCTACATCAAGGTGCCCCACCTCAAGGATGGCCTTTCCGATGACTGTCTCCAGCAGAGCAGAACAccatcgccagcaccttcgccGAAGAGC
TCCGTTCGACATTtgccaagttgaagttgcactCATTCAGTCCTCTCATTGGTCAACTCCATTTATGCTAGATCGTAGTCGCAGCCTACGTTTCAGAATA
CACTTGAATCCTTGGTTGGCGTCACACTGCACTTGACCATGAGCAGAGGACGCGGTCGCGGCCGCGTGCGCTTCGGCGGCAGCCGAGACTCGATGCTGGC
CGACATCATGGACGAGACGCGCGAAGACCTGGGCCTTTCGCACAcgcagatggagctgctccacgtcCGTATTAACCCCTTCCTTTTACGTCAATATTGC
AACACTGACAATGCGTCATTGCTCTCTTGCTACTTACTGCAGGCGGAGGCTGGTGCGTCGCTGTATCCGCCCTTAGAACTGCCGCAGCCTGAAGCTCTGG
CCGACCGCGAGGCC