Description :
From Genome Similarity Track
Location :
contig_44:402902- 406745
Transcript NameFunction/comments
g8005.t1hypothetical protein

Sequence
3843 bases(100 bases per row)
ATTCATGGCAAGTTCGCCTGAAAAAGGTGGCTCCAGTGAAGTGCCGTTCGCCCAACTGGTGACGCCACGCGCTGATGCCCCAATTTCGTTGAAATCGACA
GGAAAACTTCACAATTCTTCAGTGACCAGCAGAAGTTAGCGTCCAAGTTTTCGTTCCTGGATCTGTACCGCTTCGCGACGCCATGGGACCGCGTGCTAAC
CATCACGGCCGTCCTCATGGCGGCAGTGAACGGCGCACTCTTCCCGTGCATTGCGTTGGTGTTCGGCAAAGCCATCGGCGCCTTCGCCCAAGTTGGCGGG
GGCGTGGATCGCGGTACCTTAAACAGTGCAGCTCTGGACTATTTTCTGATAGCCATCGGGCTGTTTGTGACGGACTATTTGGCGTATCTGCTGTTTTCAC
TATCGGCCGAGCGCCAGATGAAGGCTCTTGCGTGCTCGAGCGCTGCAGCACATGCTGTACATGGATATTGCGTGGTACGACCTTCACGACCCACTGCAAT
TATCTACGAGAATCACGGGAGATACTGTCAAAATCAAGGACGGGATGGGGGAAAAGCTGGGCAACGGCATCAAGTATATATGCCAGTTCGTGACGGGCTA
CATCATTGGGCTTGCTCGCGGTTGGGATACTACGCTGGTGATGACGTGTGTCATTCCTGTTATGGGCTGGTCGATGGGATTTGTCATGAAAAAGTGGCAA
ACGAGAGCCACCTACGCACAGCAAGTGTACGCCCAAGCAGGAGCTGTGGCGGAAGAAACGCTGGGCGCCATCCGGACTGTAAGTTCTCTAACGGCTGAGC
AACGCGCGTTGGACAAGTACAACCAGCACACTGCCGAGGTCGAGAAAGGGAACATCCAACAGAGCAGAATGCTTGCGCTTATGATTGGCCTTTGCCGGGC
CTGTGACTGGCTCATGTATGCCGCTGGCTTGTGGTACGGAGGCTCCAAAGTGTGGAGAGGAGAAGCCTCGCCGAAATCTGTGTTCCAGGCGTTGATGGGC
ATTCTCATGGGCATGAGCTCCATCGGACTCATTTCCCCAAATCTTACGGCTATCCTGGAAGCCAAAGGCGCCGCTGTCGCGCTCTATGGGCTGCTGGACA
CGCAATCTCACATTGATGCATCTCAGGCTGATGGAGTCGCTCCCGACTCGTGCTCGGGTCGGATTGAGGTTGTTAACGTCAGCTTTGCCTACCCAAGTCG
TCCGGACGCTCCCATTTTGAGAGACTACAGCGTCACCATCGAAAGCGGCCAGACGGTGGCGTTCGTGGGTGCCAGTGGTGGCGGGAAGAGCACCATTATC
TCGCTGCTGGAGAGGTTTTACGACCCGACAAGTGGGTCGATTCGGCTGGATGGGCGCGATATAAGGACACTCAGCGTGAAATGGCTCCGCTCTCAGATTG
GCCTGGTGTCGCAGGAGCCCGTGCTGTTTGCTACAACCATCGGAGAGAACATTGCTGCTGGTAGAGCTGACTTTACGCGCGAAGATGTCATCGCTGCGTC
GAAAATGGCCAACGCGCACTCATTCATCATGTCGTTACCCGAAAACTACGCCACTTTGGTGGGTGAGAAGGGTGTTTCGTTGTCTGGAGGCCAGAAACAA
CGAGTAGCAATCGCTCGAGCTGTCATTCGCAAGCCCAAGATCTTGGTTCTGGATGAAGCGACGAGTGCGCTGGATGCTGAGAGCGAGCAGATCGTGCAGG
AAGCGCTGAACGAGCTCATGGCCAAGACAAGCATGACAACACTGGCCATAGCTCATCGGTTGAGTACGATTCGACACGCAGACAAGATCGTGGTGCTGGC
CGACGGCCATGTCGTCGAAGAAGGTCCTCACGACGAGCTGGTGGAATTGAGCACGGCGTGTACCGCAACTTGTACACGATCCAGGAGACAAAAGCCCAGG
AAGAAGCGTCTCTAGCTTTGTCGGACACAGAATCAGAGCAGCAGAGCGGTGGTTTGGCTGCGGCTTTGGCACGAAAAGCAAGCAATCGGTCCATGAGAAG
TGAGGAGGCAGATACAGCGGCCATGCTGACGCTGGTGGCGAGTCAAGCGATCCTGCTCCGCGAAAATTTACGTTGAGAGACGCCAACGCCCTGAGCCAGC
CAGAGCGCGGGTATTTTATCCTGGGTATGGTCGGAGCTGCAGTCAACGGTGCCTCGTTTCCAGCGTCCGCTGTTCTTATCAGTGAGCTGGTGTCGATTAT
GACGACCGACTACGCTTACTATCAAGAATACGACGATCGATCGTACCTATCTTCCTTGCCGCACAGAGTGACAGTGTACGGATGTCTGTATATTGCTGGA
GCTGCGGTTCTGTTCCTCGGCCGTGCTGCTCAGAGCTACGGGTTTCAGTATATGGCGGAGACACTGACGGCTCGCCTCCGAGGGATCACTTTTCGTCTCT
TTGCAGGCAAAACATTGGCTTCTTTGACAGGACGAGAACGCGACCGGAGCGCTGACGGCTGACCTAGCGACAGACGCTCTGCGCGTCGCAGTGATCTCTG
GCGAGACTGAAGGACGATTGTTCCAAGCGATTTTCACGACGGTCGCGGCGCTCTTGATCTCGTTTCTGGCTGGGAGCTGGCTTCTCTCGCTCGTGATGCT
TGCGATCATCCCATTCCTCGTGCTAGGAAACATGTTCCGAGGCAACAACATGCGCGGGAAAAGTATCCTAGCCGATGATATGGCGAGGTTGGCGCGCATG
CGTCTGAAGTGCTGGGCAACATCCGGACGGTGGTGTCGCTGGGTCTCGAAAGCTCGTCCTGCGATAAATTCTCGGTGCTACTAGATGCCCCCATGAAGAG
CGGTGAGCGAGACGCACAAGTGAATGGCCTAGCAGTGGGCTTCAGCTCCTTTATTGTCTTTGCGACGTACGCTTTCGCCTTTTGGTACGGCGGGAAACTG
GTGGATGACGGATCGATTTCCTTCTTGCAGCTGATGCGCTCGCTCATGGCGATCATCATGTCGTCCATTACAGTTGGAGGCTCCATCGGGTATCTCGCGG
ACACGGACAGCGCCTTTGAGGCTGGCGGGATCATCCTTTCGCTTCGAGACCGACCGCTACCCATCGACTCGTTCGGTGAGGAAGGTTTGCAGCCTCACAC
CGTCGAAGGGAGAATCGAATTCAAGGACGTACTCTTCCGGTATCCGACAAGACCAGCGGTGACAGTACTGAAGAACTACAACCTCATTATCGAGCCTGGA
GAGACTGTCGCGTTCTGTGGACCCAGTGGCGGCGGCAAAAGTACGTGCGTGGCGCTACTCGAGCGATTCTATGATCCTATCCACGGCCAGGTTCTGCTCG
ACGGAGTGGACTTGAAGCAGCTGAATGTGCGCTGGTTGCGGGGTCAACTTGGTCTCGTCGGACAAGAGCCGACGTTATTCATCGGCACGATAGCGGAGAA
CATCGCGTACGGCCTCAATACCATGCCGAGCATGGCAGAGATCGAGACCGTGGCGAAATGTCGAACGCGCATGACTTCATCATGCAATTCCCGGACGGCT
ACAGCACTCAGGTCGGAATGAAGGGCGAGCAGTTGTCGGGAGGCCAAAAGCAGGATCGCTATCGCTCGCGCCATGATCAAGAACCCCAGCATTTGCTTCT
GGACGAGGCGACGAGTGCTCTGGACTTGGAGAGCGAGAAGATCGTGCAGGAGGCGCTGGACAAAGTTGTGGCAAGCCAACGCCGCACGACCATCGTCATC
GCGCACAGACTGTCGACGATTCGACACGCCGACAAGATCTGCGTGGTCAGTGGTGGCAAGATCTCCGAGCAGGGCACACATCAAGAACTGCTAGGTCGTC
GGGGATGTACGCAAAGTTGGTGGAGACAGCCTCGTCGTAGGGA