Description :
From Genome Similarity Track
Location :
Scaffold_52:4029- 9561
Transcript NameFunction/comments
Physo_137211NADH:flavin oxidoreductase Old Yellow Enzyme family-like

Sequence
5532 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCACTAAAC
ACTTGGTGGCAATTTGGCCGGACTTCCGAGACAACACTAGGAGGATTCTGGAAGCAAAACTCGGGCATTATTTTCAGGAAGAAATACTCTACTTTTGATA
CGTAGCCATGTATTTACCAAACTACGCACTGTACGGGACTAGACTTGATTGAAATTTGTGACTGGGTTTGGCGGTGCTTTCCAATACAAACATCAAGTAT
AAAGGATTTGTATTGACCCGGAAAAAAATCGATCGAGTTTTCTGGTACATGTTGCTGAACTGAGCAAGCCCAGCATCGCTACCATGTTGAATAGACGCCA
ATGAAGACACTAGTCAGCTGACAGCCTCAACTTACGAGTATAGACCTCTCCACACTGTCAAACACCACTCTTCTATACAAATTCAAGATAGTGCGTGTCT
CCATTGAATCTTATCAACCGCGTCAGCTTAACCTTATTTGAGCAGCTTACTACAGTGAAGTGCGTCGATAAGGAACGGGCGACATTTTATATTCTACGAC
AAGACATGAATCCTCGCTTGTACCCATTGTGTGCCAATTGTACTGAATTAGTTATATGATTCTACCAATCATTCGGTCCCGTTTAACATTCCGCCAATCA
CAGTTCCGAAACCGAGCCTTAAGAGCGGCTGGATGGAGCGGCTCCCAAGTCGGGGGAAATGGAACCTAAAGGTCGCGAGAGGGAATCATGAGCATGAGGA
TCGCTGTGAGCGCGGGAATCGCGCCACGTACATGTCTGCATGCCTCATTAACCAACTTTCGCTCTGCTGCTCACAACTCCCATGGTGACCGCCACTTCCA
GACCGTTCCAGAGGCGGCTACGTCTGACCAAGCTTCAGTCGCTGCTAATCTGTCATCGCCGTCGTGATCTACCGGGTGCTACCTATGCTGAGTTGGCTGC
GTGGGCTCGAAGCCGAGACTCTGGTCGCGAAGTCCGACATGAACTACATAGTGCAGTAAATCAGTGCATTTGCTGTCTGCATGTGACGAGTCAAACCTTT
AATTATCAATATACCTTTTTCTTTCAATGTATATCAGGCGTTCCTTATCGACGCACTTTACTGTACCGGTAGGCGTTATTCGAGCTGTTCAATGGAGTTA
GTTCATTTATTACGCTTGGAACAGCTCTCCACGAGTTTGTTACCAATCTTACCGATAGCTTACCGGGTGCGGCTATAATTTTGACCCGACCCAAAGTCGG
TTTTTCGTCCATTGCAAAAAAACGGTTACAGCTTTTTCGATTCTGATTGTTGCATCTGTTTTCTATCGTATTGGTTTAAAAAAATAATTTTTGGGGTGCG
GTTATAATTTCGGCGCGCACTGTATATCACGTAGATGCGGTACCGTGTTTCTGGTACAAAACTGAGGGAAGAAAAATCCAACCGGCCATTTCCACATTTC
CCCTCCAAGCCTTGTCCTGTAGCGCCACCGCCCACCGGGACTAGCAGGCATGCCCGCGCCCTTGCCAACGTCGTCATGATACTACTGCCGCATTGCTGAC
TGTGTACTGCTGTGCTGCTGCAGATGGACATGTCCAGCCACTTGGATCCCCAGGCTTTGGCCGCGTTCGTGGACGACAGTGTCTTTGCTCAGATGAGCGG
GAAGCTTGGAGCAGACGCATCGCCGAAGAAAAATCTTTTCGTTGCGTGGATGCTGGACGACTATCCCAACAAAGCCACACTCCAACTCGAGGCCTCCCAG
AAAGAGATACAGAAATTGATACGGGTGGAGATCAGAAGAGCATACGGGCATACACGCGTGTCTCGACCTCTTGCACAAACTATTGCGGCCAAGACGGTGA
AAGACCTCCTGGCAAAGTTTGTCCCTGAAGCCCGCTCTGGCACGCCCAAGTTGGATGAAAATGAAATGAAGCGAATCGCGGAGGCGTTCATCAAGGGCCG
GTACCTCGGCGAAGCCCACCTCGACCTCGCACAGTATCTGCGGGACTGCTGGAAGGCCTACACCCCCACAAAGTACAAGGCGCCATGTGTGGCGGTCGTG
CAGAGTTCTGGCTTCGGCAAGAGTCGGACGATGCGTGAGCTCGCGATCGAGGCTCAAAAGAGCGCCTTGAACATGAAAGTCCTGTACATGTGTGCTCGTG
TGCACGAGTCGACGGGGTTTCCCAAGGCTACGAGCGAGCTTCGTGGTTGGCTGTTTCAAGAGGCTCCGAAGTGGANNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGGAAGAAGA
GTGACGCTGAGAGTGACGTTGGTGGCAGTGGTGAGGGCCACTAGGCGATCAAGGTGGCGAGACGGAAACATCCAAGAAACGAGCACGTGAAAACCAAGAG
GGTGAAGAAGCCGTCCCACTAAACGCGCCAAGTGATCCAACAAGACGCCCAAGCCCACACCGAGGCAGTAACAGTACGTGCCTGGTGCCTGCAGCAACTA
GTTTTAACTACCAACAATTTGTTTTACTTGAGAGTACGCAGCCACCTCCAGTACGCTTCACCTTGCAGTCTTACGGAAGTAGCACGTCTTTTGCTGTCTA
CGTCGTCTTTACTGCTCTACCTAGGAACGGGTATTATAGTCCATGTACCCGCGCGCGTCGCCGAGGTAGAACGTGTCCGTGTCGTAGTCGTTCACGGGCT
TGTTGAGTTGGAAGCGCCGCACCAGGTCCGGGTTCGAGATGAAGTGGCGGCCGATGGCCACGGCGTCGGCCGCGCCCTCCTCCACGATCTGCACGGCCGA
CTGCCGGTCGAAGCCCGACGCGGCGAGGAGCACGCCCTTGTACGTCTCGCGGAACTGCCGCGCCGAGCCCTTCTCGGGTGCCAGCGGGTTGCGCACGTGG
TAGCCACGCGGCTCGATCAGGTGCGCGTAGGCCAGGTCGTAGTTGTTGAGCCTGTTCAGCACGTACGTGTAGGTGGCGATGGGGTCCGAGTCCTTGTCGC
CGAAGCTGCCGCCGAACGGGGACAGTCGGATGCCCACCTTGGACGAGTCCAGACTCTCGAGGATGGCCTCCAGTGCCTCGAACAGGAAGCGCGCGCGGTT
CTCGACGCTGCCGCCGTACTGGTCGGTGCGGTCGTTGATGCCGTCGTGCAGGAACTGCTCCAGCAAGTAGCCGTTGGCGGCGTGCAGCTCGACGCCGTCG
AAGCCCGATTTGAGGGCGTTCTCCGCGGCCGTGCGGTAGTCCGACAACTGCAGGAACATCTTGCTGTGCACGGCCTTGGTCACGTGGCGCCAAGCCTCGA
TCTGCTGGGGCGCGAAGATGTCAGGGGAGCCCCAGGATCCGCGGCCCGTGGGCGTGATGTTGGTTGCCTCGGCGATGATGAGGCCGCCGGGCGTCGCGCG
CTGCTTGTAGTACTCGACAACTGCAGGATTTCTCGACGTTTTCCTACTGCGTTTTTGACGCAATACGAACGATGTGAAAGTAGAGTATCGCGGCGATATA
TACGTTATGGACACCAGGGCCTCAGAGTTTTAGTTTTTCACACTATTAGAACGCCTAGGCGTTGTATTCGGATAGACCGCCTAGTAGGCGTTCTATTTCC
TTTCAATGCCTGGGCGTCTGGTACGGGGTAAGACAGTAGCAGGCATGCCCCCATTCTCGCCACCGCCGCCATGATACTACTGCCACTTTGCTGACTGTGT
ACTGCTGTGCTGCTTTGCAGGTGGACATCCAG