Description :
From Genome Similarity Track
Location :
Scaffold_32:402870- 406304
Sequence
3434 bases(100 bases per row)
TCTTGTCCAACGGCTTTGTGAATGCGTCTGCGGGGTTCTTGTCGCCTCTGACCTTATGCGGCTCAATGATTCCCTTTTGAGCTTGTTCTCGAATGTAAAG
CCATCGAAGTTCGATATGTCTTGTTCTGCGACTGTAAGTTGGATTGGTCGCCAAGATATGGGCAGCCTGATTGTCAATCCCGAGCTTCAGATCATGTTTG
CATTGTGGAACTACTTTTTGCAGTATGCTACTCGCAGCTGTAGCTTCCATAGCTGCCTCACAAGCTGCAACATACTCGGCCTCCGCTATTGAGGGTGCCA
CGATAGACTGACGTCGCGACATCCAGGAGATCGCACCTCCATCAAGCGAGAACACGAATCCCGTTGTACTCTTTCGCGACTCTGGGTCGTTAGCCCAGTC
ACTATCACAATAGCCTTCAAAGACTATAGCATCAGGTACTTTATCCGCACGATTGTACGTAATATCATAGCGCTTACCGTTCCAGCAAGATATCTCAAAA
CACGTTTTAGTGACCCGACGTGCTTGGTTGACGGTTTGGCCACAAATCGACTTAACCGTCCTACTGCAAAAGCCAAATCCGGTCGTGTACCAGTAGCAAG
GTACATTAGCATCCCCACGGCCTTTCGATATTCGAAACTGGTGTCGGACTCTTTGTTCTCACTGAGCGATGACAACTTCACGGTAGTCTCCATCGGGTTC
CCAACTGCGTGGGCCTGATCATATCCGAATATCTCCAATACCTCACGTGCATACTTGCTCTGTCCAATCGTGATGCTCTTTGAGCTTTGAGCTACCTCAA
TGCCCAATTGAGGTAGCTCAAAGTTTTGAGTCAACAGACCTTGATGTTTGTTGCCATAAACCATATCCAGGTCCTCGAACAATCTCTCCTTGACCTCCTC
ATCGTTCGTAGCCACCATGATGTCATCCACGTAGACTAGGATCAGCATGACGGTGCTATCATTAAAGCAATAATACAGACATGGATCGGTCATTGATCGT
TAAAAGTAACGCTCAAGTAGCCATTTGTTCAATTCAGAGTTCCACTCTCGACCCAATTGCCGTAGTTCATACAATGCCTTAGCTACCATGTAGACCTGTC
CGTCAACTGCACATGGAAAGCCGTCGATTGATCTTAGATATTGTCGTATCCTTAGCAGCGCATTCAGATATGCGGTGCTGATATCCCCACCGTACAACTG
CAAATACAATGCCGCAGCCAGAGCCACAAGCAAGCGAAACGGCGACATACGAGCCACCGGCGAAAGGGTCTCACAAAAGTGAATCCCTGGTCGCTGGTAG
TTACCGAATGCCACAATTCTCGCCGTGAAGCCAATTACATACCCCTCGTGATCTGATTTAAGGGTATAGACCCATCCAGTAGTAAGCATCTTGGCGCCTT
CGGGAACTTCCAAACTTGGTATCTCCACAATGACACCCTTCGCTCTCAACGCGGTTATCTCATCACCTTCTGCTAGCCCCCATAAGCCTGCAAATTTAGA
TCGTCTGGCTTCGCACCTTTTTCGAGGAATCTTCACAGTGCTAGCTTTGATATACTGACCACTCGAATCCTTGATCCGAGATGTACTCTGGATTGCATTC
ACGACATAGTCATTCAGGTACGCAGGCCGACGTCGTTCGTAATATTCGCAAAGGTCTGTACGTGTGCGTTTCGCTTCCGGTTTGTCAGCAGGACGCTCAA
CACGCAACTCTTCCGAATAAGTCTCATCATGATCAACGCGTTTTCCGGTTTGCTGATGATAGAGTAAGCTTATATCCATAACTTCACGGCTCCCGATTGT
ATAATCCAGGTCATTGTTCATCTTTTGTATCTCAGTAACCTAGCGATCCAATCGAGCTAGCCACTGTAATATCGTCCCCATTGGCGGCATCTTCAGGCAA
CATATCGAAACAAGCTGTTTCCTCATCATCCGCAATGGATCCGCACACTCCAGCCACCGATTCGTTTCCATCACTAGGCAGATCAGCATACGAGACTACC
TCCCCATATGCTGATCTACTGATTTCCTGCGAATGCGCCTGGAGCTGCTCAGTGCTCAGAACATTCATCGTACTCTTATCCAGCGTGTTCGACACCTTGT
CACTGCGTGAATTTGTCTCCACAACCGCCTGTGGATCATTATCTGGAGTTACATGCCCTTCGGATGCATCACTGTACTCACTTCGTACATGCCCTGTACA
CATCTCGGTATACGCGTCTCCTTCGTGTACTTCCGATACTACTGTACCCGGATGGTCAATCTCAGAGGCTTCGTCCACTTTGCTCACCTCGAGATCCATG
GTTTCTTGGGTCTCAGCCACACTCAAATCGGACGAAACTGCCGAGGTTCGCATGTTGAACGCATCGGTAGTACTCCCCAAGGACACATCTATCTCATTGA
ACTGCTCAAAGTGTAGTGACACTAGGTCAGAGTCATCCATAGACGCATTGTGACGATCTCGATACATCACGTCTTCAGATAAATCAGCCACAAACTTCGC
TGTTCGGTCATCTGGAAAGAACACTTTACACCCCACGACATCTTCAGCATAACCGAGAACAAATTTTTGTTTGGCATTACCGTGGTGTTTCTTGCGTCCA
GGGGTCACAGGTACATGTACGTAAGCCAGTGCTCCGAATTTACGGATATGATGTAGATCAGGTTTACCCCCCCCCCAACATCATCTCGAACGGTATCCCT
CGAGTTCCTTTGTTGAATACTCGATTCTTTATGTAGCCAGCGTTGCTCAGAGCCTCCGGCCGCATACTCTTGGGGAAACCAGACTGATGCATGGTGACTT
TGGTCATACCAATGAGCGACTGGTCAGTACGCTCACATGGATTCCATTGCGAGCTCTTCGGAACGACGAGAACATGCTCGATACCGTGTACTTTGTACCA
ACTCTCCATTTCATCGTTGACAAACTCACCACCTTTGTCCGTCAAAATCCTCTGAACCTTGTATGCCACCTTCTCCAATTCACTATGTTGTCTACCCGCT
TGACGCTCTGCCCACAACACATACTCCTTGATGTGGCGGTTAATAACAAAGCTTAATTTGCAAGTCAGCATGGGAATTTTGACAAAGCGCGAGTAACCAT
TCAGGATCACAAGGACGGCTTCGAACCTAGTTCCATAAACTTTGCTTGGAATCAGAAGGTCGACGTATACCATCTGATTCGGAAGCCCCAGGTAGATTCC
TGTGGTGCTGCCACAATCACTGTTCTCCCCTCATCCATTACCCTGAAGTTCATGGTCTCACGATCATAATCGAAATCAAAGCCCTGCTCAGCAGCGAGGC
CAGGAGATAGAAGTGCATGTTCAGCTCCTAGTAAATAGAAAACATCATATAGGTACACCGCCACCGGTTTCCCGTCAACTTCGGAGACAAAAGCAGCTGT
TCCAACACCGGCAATCATCGATGCAAGTGCTGTG