Description :
From Genome Similarity Track
Location :
Scaffold_332:40285- 41526
Transcript NameFunction/comments
Phyci_35310Hypothetical protein

Sequence
1241 bases(100 bases per row)
ACCCAGTAGAAGTAGATCTTGCGCAGCTGGAAGCTCGGCGGGAACCGGACGTGGCCGCACTGAGGGCATCGGTAGCTTTCCCACTGGTGCATGATGCTTC
TGAGGATTGACGCGAACGGGGTCACGCCAATGCCCGCGCCAACCAAGACGACTTCGCGATACCGAGAGTAGTCTTGTGCAGGCGCGCCGATGGGCCCATC
AAGAAAGATTGTCGGGTACGGAGACGAAACTGGGCAGCCTTGGTCCTCAGCTTGCGATATCTCATACTCCTTGTGCAGTTGCTGCAGCTTGTCGTAGAGT
GCCCGAGTCCAATCCCCCGATTTTTGGATATGGAGACTGATGAATTTGTCTTCTGGCGCCGACGAAATCGTGAACGGATGCCACTCGAATTTGGAGATTG
CCGGTACATTGACGAAGACGTACATGCCCGGCAAGAAACGCTGTCGCTTACTGAAGGACCTAGGTTTCTTCATGAAGATCGCCACCGCCTCCTTCGAAAG
CTGCACCTGAGCGATCTTGGTCTGTCCCCCGAACACTTGAGTCATCCGATAGCGCTTCTCGATGAGGTAAATGATGATCGGAGGCAGCACCCAGTAGTGC
GCTTGAGGAGCAGCCACCCAGCGAGCGAAGCCGTGGAACGCCATCAAGACGAGGAACGGGACGAAGAGCATGTGCGAAACCCAAAACAGGTTAAACTTGC
CGCGACGAACCTTTTCGAGGCACAACGGAGCAGCGATGGCGGCGCAAATGAGCATGGCCACGCCCGTCCAGATCGGCACTCGGAGTGCAAAGAGAAGCAG
GTTCTCGTCGCGCACGAACGTGAGGTGGTGATAGCGAGACTCCTCCCACACAGCGAGAGGCACTGTTCAAACGTAAATCACGATGGCCAGCCAAGCCGCC
GTGTGTCCGAGCGAGGCGATGAGCAAAACGACACCGCATATCTTGTGGAACTCGATGTGGTTGTCGATCGGAAGGTGGCTGACGACGACCGGGAGCGTGC
GAAGGCCTGTCACGAAGTTCCGACACATAGGCAGCAGCACGAACATCGTGTTCACGAGACAGATCTCGGCGAAGCCCTTGGCGATGCGTGGACAGTTCCC
GACTGCAGGGTCGTAGGCGAACCGCGAGGCCTTGGCGATGAACACTGCGACCATCAGCAGGAAGTAGAGCGCCAACCAGAAAATCTCGGCATTGTATCTG
CGGCAGAACTTCTTGATGCGGTACCAGTGTCCACCCTGCTC