Description :
From Genome Similarity Track
Location :
Scaffold_2398:4028- 5124
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2398-fgenesh-gene-0.0Oligopeptidase A

Sequence
1096 bases(100 bases per row)
GAGACGGGCGCGCCGCTGCCCACCGAGCTCTTTGAGAAGATCAAGGCCGCGCGCAACTACATGGTGGCCACGGTGATGCTGCGCCAACTGGCCTTTGGTG
CGCTCGACATGCATTTGCACGAGCACTACACGGGCGACGAGTCGATCTTCGACATCCAGAAGCGCATCCTGGCCAAGTACGTTGCGTGTTGTGGCTGGCT
GGATCGTGCTTGACTCAGACTCACGGTTGTGCTGCTAATACAGGTACTCGGTGCTGGAGCCGCTGGACGAGGACCGGTTCCTGTGCTCGTTCAGCCACAT
CTTTGCTGGAGGGTACGCGGCGGGGTACTACAGGTGCGTGTTCGTCACTTGTTATCTCACTGACTCATTCCGACCTGGCTAGACAACTGACTGAACGCGC
GTTCTCCACCACTTATTTATTATTTGTTTGAGCAGCTACAAGTGGGCGGAGATCCTCTCGTGCGACGCGTACGGCGCGTTCGAAGAAGCGCAGGACGTCG
AGGCCCTCGAGCGCGTCGGCCGCCGGTTCCGCGACACGATCCTGGCTCGGGGCGGCGGAGAGCACCCGCTCCAGGTCTTTGAGGACTTTCGCGGTCGCAA
GCCGTCAGTTGACCCGCTGTTGATTCAGTACGGTCTGCTCACCAAGGGCGACAAGGTGTCTGCTTAGCGATTTTGCTCATCGACAACCAAACTAGAAGAG
CCTCTTTCGGAGAACACGAGGCTTGCCTTTTGGACACCACTCACTTGCTGAAGTCTCAAGCTCATCCAGAAGGTCACGAACCAACCATCCAGGAGTCCGC
AAGGCGATCTCTTTATTATTGCGCTCACCACGTTAACGATCGCGGTGCTTTGATGTGGTCCAACTGGGCGGACAATCTGAAAACACGCCTTCTGACTGAA
TCACTGGTTGCTGCGCTCTCCACCACCCATTAGTTAAGGAGCGCTCATTGATCGGGTCGCACAGCACAGGTACAGTACGCACTCTTCCATGGACAAGTAC
TGCTCACCAAGAACAGACGCATGAACAACTCATACTTGCTTGCTTGACCTGTCTGTTCATCCACGTGGCGCTCTCTCCTCTCGCATACAATAGATT