Description :
From Genome Similarity Track
Location :
Scaffold_44:402783- 405163
Transcript NameFunction/comments
Hyaar_Emoy2806008GA24192, isoform A

Sequence
2380 bases(100 bases per row)
TCCTGCTTCTTCTCATGACGCACGGACCAAGGCAAGCTTGGCGGCCAAAGCCCATCCAACATTTACTGGACAGGCTGGCAGTAAAAGAGGTTCCGAAGGT
GGTGTTGGCGCAGCAGCAAAATCGTCGAATGTCGCTCATCTGATGCAATTGCTTAAGCGCAAGCAGCGCGCTCCCTCTCCACCACAGCAACTAGCTCACG
AGAGTACTAACGACGTTCCTTGTGCCCCTAATGCAGCAGCTGTCATGTCCATTTTGCAGAAGCTGAAGGGATGGCAAGCCGAGTGCTGCGTCTGGNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGTGGGAAATGCTCGAGTACCGGTCGACGAGTCCATCACGCGCTGTCAAATATGCGGCGAGAGCTTTGCAAAAA
GCTGGGATGAAGAGGAAGAGGATTGGATGTACACGAACGCGGTTACCGGCACGATCCATAACACTGGTCCTAACGGTAATGAGGAGCAGGACACGATTTT
CCACAAGTATTGCTACGACACAGTGTTAGCAAACTCGACACATGTCACGCCCGCACATTTAATTCCCGCAGAGAGAAGTACTGCAGTTAATATGGCGGGT
TCAAACGATAGTATGGATGGCAGCAGTAGTGGCGTGAAGCGATCATTCGGAGAGGTGCGTATAGATGATTATGGTACAGAACTTATTCTGATTAGACTTT
TGATTGACAAGTGCTGGTGTTGTGTGGGTTATAGGACGACACCGATAGTGACGGCGACGATGATGTGAAGCGAGTGAAAACTATCTGAGTTTTGGAAGCG
AAGCTGGAGGACAGAATGAGATGCAATGTCACGAGGTGTAACGATAAAATAGTTTGATACTTGTAATTGCTGGTGCGGCACTCCGCCGAGAGTCAACTAC
GGCAGGTTTCATCTCGTATTGTTTGCTATCCATTTCTTCAGCTTCCAGCGCGACATTCAGTAGTACTATGCTTTAATACACACGTCACTTTTGCACTACT
CGTGTTTGGCATACGCTATCATGGTGTGAGACTACTCTCAGCTTGAAAGCTGATTACTGAAGTGCTTTTTCTGCAGTTGC