Description :
From Genome Similarity Track
Location :
Scaffold_33:402708- 406512
Transcript NameFunction/comments
Phypa_INRA-310PPTG_13566voltage-gated potassium channel subunit beta
Phypa_INRA-310PPTG_13567hypothetical protein
Phypa_INRA-310PPTG_13568hypothetical protein

Sequence
3804 bases(100 bases per row)
TCGACATGTCTGATGGGTGCGTCGAAGATTGAGCAGCTCGAAGAGAACCTGAAGTCGCTGGAGTTTGTTGACAAGATCACGCCCGAGATTCGCGCGAAGA
TTGATGCCATCGCTGACTTTAAGCCGGCTTTGCCTACGATCCAACCGCTCGTGCATCAGCTCCGTCAAAGATGGCTCTAAACGAGTGCTCCCTTGCTATG
AGTTTGAGGATTGATGCAGCCAAGCAAATTGAAAACTGTAGTCGGCACCTGCAGCATTAACCGAAATAAAGATTTAATCACACCGACTACCAAAACTATT
TAAACTTCTCTTACCGAAATGTACCAGAGATGACTGTACAACGTACAATACCCATAGAACCAGCTTCGATTGCACCATTTTCCACTGGTTCCGCAGCACG
AACCCTAGCTGACATACCGGGGAGTACTTAATCGATTTGCGAAGCACGAATTCAAGCACAAGAATCGAAATGAACTCTAGGAACCCATACAAAAGCACGT
TCGACAGAGTACTTTGCAATCCAGCAGCGCCCATATCCGCGAGTTGCGGGTAATATACACGGTTTGGGAGATAGGACATGGCGCCAACGTAAATGGCTAA
TCAAAACAAGCATGAGCTTAGTTAGATGTACTGACAGCGAAATACAAAACAAGTAAGACTGACAGTAGACAACCGGAACGATGACCTCTGTGTACTCGAC
CAGGATCATAAACTCCACCAAATGTAGCAGACGTGCCACCTTGTGAACATACACGACCTTTATCTTTTCCAGTCGATATTCAAGTGTTTCAGGCGGAGGT
GTACAACATTTAATGTCGGCTTCCGTGGGTTGATCTTCTCGAGGTTCTTGTGACTTCGAGGTCGAATCGTGTACAGCTACAGATGTTCTTGCTTTCGAAT
GCGGATGTACTTTATTATCTCGACGAAAACACCACAAAGTTGCGCTTTGTTTGCTTGATCTCTTTGAATGCTGATCAAGCGTATCTTTATCAAATCCACT
CATGTGCTTTAGAATTGAACACGCACGTGTCATGGCATTCATGCTTGGATTTACTGTCGGCTCTGGACCCCGCACCAACGCTTCATTTAAGTCTAATTGC
CTCTTAATTTCCTTCAGTTCTCGAAGCATGAGCAAGACTTCACGCAGAGAAATAGCGATATGCAGAAGATCAGCTGCCATTATAACCGCAATTGTGAGCT
TTGTAGAGGAGTTTTGCATGCAAAACGACGCGAAAAGCGCATTGAAGACTTCGACGTTGAAGATCACAATTTCAGGCTTCATGTCCGTCTGCGATCGAAT
GTAGCGGCTGATTCCGTTCTTGATAGTCATCTTGATGACGTGCAACAGTAGCGAGAATGCGGCCTGGGCCACATGTGACAGTTTTGTAAAGCAGTAGATG
TAAAACGGGTATATCACGATCATGGACATTTGAATCACGAATACTTTTAACCCGTCTACAATTTGCCCTTGCACTCTTGTGTCGGCTCGGACGTGTTTTA
CCCAACTAATTGCAAAGCAACTCAGGAGTAGAGTCGTCCAAACGGGGGCGCCCATAACCATCAGGAATGGAACTGGAAAACCGATGATATGAGACAACGA
GTAGCAATAAAGCATTACACCAGTGCTGACAAGAAGAGTTACACCAAAACCGCGAGCTTGAGTCATTGGTAGCTTGGGCATCATCTCACGGAACTGCACG
ACAAATGACAAAGTGAAGAACCACACAACCATCGACCCACGCAACCAGAAAACCATATTGGAGTCTGTCCCAACTTCGGGGGAATTCAAGGGCGTGAAGT
CAGCGAGAATTACCGTGAATAGGCATGGAAGTGGGGTAAATAGGATAATTGCTGTTAACCCTGGAATACTGGCGGTGTTTGAGTAGTTCTGAAGTTCAAG
CAATCGCTCAGCAGAATAGTGACCGTGCAGTTCCACCTGGAGAGTATCCCACGCATCAATACTCCGAGTGCGCCACCTGTGAAAATGTCCAGACATATTG
CTGCTACAGAATCTTGAACCTCGGAAACGATTGAGGCCTCAAGCGCTCGTTGGATGTCCCCCCTAATTTGAGTGCTGAACCGAACTTAGTTCACTCGAAA
TGTGAGGACAAGGACAAGGGACGACGATGGATTTCACCAATGGTTTATCGATGATACTAAATAAAGTTACATCGGAGCTGTGTGCGTTGACAACTGGCTT
GTGGGATAGAAACGTCAACCGAAACGGGGCTATAGTTTTGACTTAACTTCACGTAGATTTTCGTTTTCAAAATAAAGTTGCATAAACGAGTCTTTTCCAT
CGATTAGAAACACGATAGAAATTCGCTTGCTCGCTTAGAAATGGATTTTTCAGGTTGAAGTTGCATAGACGAGTCGAAGTCTATTGGCCGTTTAGAAATA
GAGAAACTCCACTAGAAGTGTAGTGTTTCCAGTGGTAGACATCGAATGACGGGCATTGCCCGGGGCAACCAATGCAAAGGTGACAACGTCATGCTCGGTG
CAGCTATCGATAGTAAGATAACCGAGCCAAAGAGTCTTGTTACATGTTGTAAGGTATGATCGTATCATGCTGCTGCGCTCTCTGATTCGCGCGTGTCTTG
CTCCCGCTATTTTTCGAAAACTAACGGCTACCTCTAGGCTCGAAGCAGCCTCTGACGAAGTAGCACCAAAGAGCACTTCTCGTGTAGGCGTGCATGGCTG
CAGCTACGAGAGGAATTGAGCTCAAGTTGCACACGAATTACTTGCGTACACTTTCCAGTAGTGAGGGAGGTTGAGTTTCAATTCATGTGCTGCACTGCTC
GAGTACGAAGTACACGTCTATCTACGCGTTTTTTTAAAATCAGGATTTACAAATGCATTGAGCATTAAAACAAAAACTATTGGATCATACCGAATTCATC
GTCATTTTCGTTTTTGTTCACGCAGCGCTATCGTAGTTGCACCTTTTCAAAAGCGAGCTAATATCAACTTGATGGTAGAAGCCATTCAAGAGGACATTGC
ATTCAAATAAGGTTGCGACTGTGCGCGACATCGGGGATCGCGCCAAGCCGCAAACAAAAATCAAAAACAAAGAAAGCTCGACGTATAACAACACCAAAGC
ACACTTTTCTGTCAACAACTAGCATTAAAAATCAATACGCAGCAACAGCTGCCGCCTCAACGTTCGACAACGTCACTGCTCATACACACATGAACTAACG
CACTCGAGAGCCTCATATTTGCTAGCTTGCTTCGCCAGCCTGGCCTCAGTTGTCTTGTTCCGGATAGCAGAACCCTCGAAGAAGTGCAACCAGTTTTTCG
GTCCCTTAGGCGCCGGGAACGGGTGAGCTCTTCTTCAGCTTCAGAGCCGCCTGCGCGGCCGCCAGACGAGCGATCATCACGCGCATTGGAGAGCACGACA
CGTACTTGAGACCCACCCTCTCAAAGAACTCGATCGACTGCGGGTCTCCGCCGTGCTCGCCGCAGATGCCCAACTCGATCTTGGGACGCGTCGCGCGACC
ACGCTCCACGGCCAGACGCACCAGTTCGCCCACGCCCTCCTGGTCCAGCGTCTCGAACGGATCCTTCTCCAGCACGCCATGTTTCACATAGTATGAGAGG
AACTTGGCCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNN