Description :
From Genome Similarity Track
Location :
Scaffold_70:40268- 73731
Transcript NameFunction/comments
Phypl_g2354hypothetical protein
Phypl_g2355hypothetical protein PHYSODRAFT_537941
Phypl_g2356glycoside hydrolase, putative
Phypl_g2357hypothetical protein PHYSODRAFT_551993
Phypl_g2358hypothetical protein PHYSODRAFT_248380
Phypl_g2359hypothetical protein
Phypl_g2360Mitochondrial/chloroplast ribosomal protein L13
Phypl_g2361hypothetical protein
Phypl_g2362hypothetical protein PHYSODRAFT_353502

Sequence
33463 bases(100 bases per row)
ACGGCGGCCGACGTCTCTGCGCGGAGGCTGGctgcgagcgcgtggcgcagTTCGGCCACAAGTGCAGCGCGCACGGAGGCGTCaagttctgcagcgtcga
agggtgccagcgcgccgtgcagtcccgcggctgctgcaagacgcACGGCGGAGGTGTCAGGTGCCAGCACCCTGACTGCACGAAGGGCGCCATCTCTAAG
GGTTTCTGCCGGTCGCACGGTGGCGGGTCGCGCTGTGCTGAGCAAGGCTGCCAGAAATgggcccagcgccttggaTACTGCGTGCGCCACTCAAAGTGTA
CGACTGAAGTCAAGGCAGCACCGAATAGCCAGCCAGCCTCGGAGCCCATGGTTGACGGTACGATCCCATCACTAGaatcaccaccaccaccaccgaaTAG
TGCGACTTATTAGCAGACAACTATGATAATGTACGACACAAGGACACACATACAGTAGTACAGGGTGGGCTTGCAGCCCGCAGTAAAAAGCACCtgtgtg
caccacatcacGAGGGTCATTGACCACGAGGTTTATTGGATATGTCGGCCCCGACATATCCGATTCCGACCTCCGATCTCCGATACCCGGCAAGTATTAA
ATTCGCGATTAGTCTTAGTGTGTCCACCATCCAGCAAGCCAGCACGAGGCAGCTACAGTACAAGCAGAATGCAGCCAACACAACCTCCAGACGAGTACTT
ATCGCAGCAGGAAGTGAGACGCCTTACTAGCGAAGCTTTAGCAGGGAGACGTTTCCCCCCGGTCCTGCAGTATCCGGAAGCGAAGCGTGGAGATTTTCTT
CTGTCAACACTGTTTACGTGGCCAATCATCGTGTGGGTTCCTGAGTGCATCAATCGCTCTCAAAAGCCCTTCTGTGTGATGCCAGGGTGCTCGTGCACAC
CGCGACTCAAGGAGTACAAGCAGCGAGTGGTTGAGGAGGTGGACACCAAGTGCCGTTTTCTCTACATCAAGTACCAGTGTTCTGGGGACTCGAAAGGCTG
CTTTTCGACGGTAACGCCGGCTTACCTACAGCGAGAAGCCCAGCTGCTTATGCATTTTCCTTATGTACTAACCAAGAAGTTTGGTTTGTCGAAGGAGATG
ATGGAACTTGTGCACGAGGGAATGCTATCTCCGAATGGATTGTCGAGTACTGTGGAAAACATCAAGCGCCGTCGTGAAAAGCGGTATTACAAGCTGCTCT
GCCTGTTTGCAAACCAAATACAAAACCACCGGCTCTCCAACCCAGTGTATTTGGCGCCATCACCCCCGTCAGCTCCACAGTACAGCGCGAAGCAGAGTCC
TCTAGGACCCGAAACATTGTCGGCAGCGTGGCTGCAGACGTCACGAATTTACAGCTCTCTTTGTGAGCAGATAATGAGATGTACCAAAGTGAAAAGAGCT
CTTCGGATGGACCATCCCGTCAAGTTCTGCAAACGGTTGAAAGTTTGGCCGGGCGGTACAGGCAAGAGAGAAAGCATGAAAGACGCGAAGATGTTATTGC
TGCTCCAAAACGAAATTGGACAGATCGTTGGACGCCGGCACACCCGATCTGAAAACAATGACGAAACCTGCGCGCTGTTGGAGCACGTAAAGAAACACGC
GATTCtagatgaagaagttgccAGTCAGTGTTTCATCATCAGTGACAACGCTAACGCAGTTCGCAATATGGTGAATAATGTATTCGGTGGCTCTGTGGGC
GTTCGCCAAGACCCTTTTCACGTGATCCAGCGATTTACTGAAAAGGTGAAAGACAAGCCGACTAAAAAGCGCCTTgcgaagcagcttcatgaagcACTTT
ACACTATTGATGAGAGTTTGCGTGTGCCGTCTGAAATGGCTACTCAAGTTCGAAAAGCAGTGAGTTCTGTTTCATTCAATGACATTAATTGCAGCGAGCA
AGATTGGCGCGGAAGCTTGAACAGCAACTTGGCGCAGATAAGTCAAGGCGACTTGTACGTAGAGTCCAACTCGTACGACGAAGGTGGCGGTAAGAGCGTT
CGAGTGCTATCCACAAGCCAGCTGGAGGGATTTCATTCTGccctcaagaagctgctaGCTCGGTCAGTATCAGCCGAAGTCGGGCTCCGCATTCTCGACG
TATTCATTGTGCGGCACAATCTCAAAGTCGGGTTGAAGTACGGCCGCAATCCACCGCTAGAACACGCGGATCTCGTTACACTGGCGCAGACCGCTAGTTT
GTGCCGAGGAACAATTCCCGAGTCTCCTCAATTGGAATTTGTGTCGAAACTTCTATCCGCACCACTCCCACCTCCGCAATATCGTTCGACCACAGAGCAC
GACTTTGTATTTGAGCAATGGGGACAGCTGTTCGAGACGGCTAGAGTCGATACTGCTGCACTAGAGCTGAATTTGCACCGAGCGCACGAGCACCGCACCA
GCATCAAGGAACTGTTGTCCAAACAAGCCGTGTTTTCCAGCACTAGTCGCTTACCGAAAGCCGATTTCTTCAACTCGCTATGTCTCACCGAGCTTGAGTA
CGAGGCAGCAGTAGGATTTTCAGCGGAAGAattggcgctgctcaagcagctccgtAGCGAACAAGCGAGGTCTGGCGAGAGTTGGGCGGAATGTACACTT
GTCACCACCATCATGTACAACATAGTAGTGACGTCAAATTCCAACAAGCAGCTGGAGTTGAGACGCCGTAGCTTCGCCACGCTAGCTGCAAAAGTTGATG
GTCTGTCGAAGCGCGAGACGGGAGCGCAAAGCAAGTCGAGCCCTGCTTCAGCTAGAGAATTGTTTCAGTTTGCAACTGAGGATTCGACATGTGATGATCT
CACGGGTTACGAACAAGCTTTTCAGATTGACCTCTTCAGAGCTCTTCGAGAGCTGAATGGACTCAAGAAGAAACGACAAGTATTCGTCCAGATTTATGAC
TTCGCCAGTTGTGTCTGCAGCGGTATTCATCGAAAATCCACAGCGCATCTGCTGGCCAGGTGGGAGAACATGAAGCGCGCTTCAAACCGTGGTGCATCTC
TGAAGATCAAGCTCAAACTGCCACCGGAGCTAATAGCCACCATGCGCGAACAAAGTACAGGTGGAGCTCTCAGTAGTAAAGCGCCTGCGCAGCGTACTCT
CACAGATGCGAACGATGTCGATGAAGACAATGCTATCCATCAATTTTGTGGTGTAGACATTGCCGTGCAATCCGCGACATCAGACCTGACACTAactccg
acgacggcacgTCGATCTCCACTACTTGTCGGCGGTGACGCAAATGTTCAACCTCttcccagcagctccaattCAATCCACACCAGCTCTGCCAAACAAT
GCAGCAATCCTTATCCAGCCAACCAGAGCCACACGAGCACTTTGCCTGCAACAAGCAATTCACCGTCCAAGATAATGGAGGTTGCCTCCGTTGGTGCCTC
ACGACCAACGTCATCACCACATGTACCGACCTTCATAACCCAAGAGCACATCGATGAACTCCGTAAGTTAGAAGGCGAGCTACCAAACAGAAGTGGAAAA
TGGAGTCGCATATATCGTGAGTACACAGAGCTCTATCCAGATCCAGACTCGCGAATCTCACTGAATGCGCTCCGTTGCCGTCTAAGGCCTCCCACAGCAC
CACGACAGAAGGCAAATGCAGTGGACCCCGCACAACTATCTTCAGTAACGACCACACCACGCAAACGAAAGGAGACATCATGCGCTAGCTGCCACCAGCG
AAAGAAGCGATGTGGAGATTGGTCTGTCAATCCACATTGCATGCGTGCAAGCAATACGTCAGCAGATAAGAGCACTTTTTTTCATTGTAATAGAGTGTTT
CTGTCTTCTCAACATACCTGTGACGTCGCTCCCCTCTCTTCATAATGTAGCCATCCTAGAGCCATCACCTCTGCAGAGCTGCACACACTTGATGATCGCT
TGCGAGTATTgagtacttcgaagtagctTGGAAATGCAAGCCTGCTGCGCAGAGGGATGCATGTCGATGCTGGATATGGCAACCTGCGTAATGGTACGTT
GTAGCGACTGTTAGCATGGTGGACGTCGGTTGCATCGTTCTGGAGGTGAGGCAGCGGCTGCACGAGCCGTCGTACGCGTTGAGATCGATGTGCAGGAAGC
CAACGTGCTTGCCTTCGCCAAGTGACGCTTCCGAGTGAGATCGACGATAGGGCATCACAGCTTTTGTGCGGGATACTGGGGGCAGGTGAGACAGATGCGC
GGGACACAAAAGTGGTGAAAAAGGGTTGTAAAAGGTCAGATGTGGTGGCGCCCAGTCGCGGGACAACCCCCCAGTAAAAGCTATAAACCCCGACCACGAT
GGACTCCAATGCTCATGACCCGGTCCACCTCAAAGACTTCGCGGCTCAGTGCGTGGAGCCGACGCAACTGCCGCAGTTCACTCCGGAGTCTGTGCATCTG
CTCGAATCCTATGCGTCGCACCGCGATACTCGTGAGAACAGAGCGGTCTTTTTAGTGGTCAATTGAAACGATTCCTGCTGACGGTGTGCGTTAGTGGTGG
AAATTGCATGCAAAGAGCGATCGGGTGGCTGCTACTACGGCAACGAGAAGGCCAGGCAAAGCGTGGAGCTCAAGTTTGGCGACTTCGTTGACTACTACCA
AGCAACGTTCAACAAGCGGTCGCATTGGCTACAGACGGTGGACGACCTGGAGTTTTATCTGGCTCAGTGCCCCATCGCAGTGCTCAAGCCTGATGCAACG
TGCAGCAAGGCGATTCTACCGGCGATTATGGACGATTTCCGCTTGTAAGGCGTTCGAGTCATTGGCATCTCGTTTTTCTGTGAGTTTGACCCGTTGCTTG
TGTGCTACGTGGCAGACCGACGTGTCTACAGGACAAACCTGTGACCCAAGTGAATCTGTGGATGACGGTGCAACCTGGCCGGACGACGCTGCACTATGAC
GCGTATCAAAACATTCTGGTCGTTTTGTACGGGAGGAAGACTGTCACTCTCTATCCTCCGTCGGACATGGCGAAGCTGTATCCGTTCCCGGTGCACACCA
AGTCTGTGAATCACAGCCAAGTCAACATCGTGCAGCCCGACCTTGAGAAGCACAAGCGATTCCCCGAGGCACCGGCCCAGACATTCGACGTTACGGCAGG
AGGTATAGTACTCTGTTCTTGTACTCCGCTTTGATCCGTGGTCATGATAATACTTTGACGATTGTCCTGTTGCAGACGCACTTGTAATCCCTGAAGGGTG
GTGGCACCAGGTGGACTCGGCCGAGTTTACCATTGCCGTCAACTACTGGTGGGATGGCGCGCGAGAACAACTCGTAGCAGATAAACGCATGGTGCCTTAC
TACGCCCGTGTcatgctggaagagctggtcaAACAGCAATGTGAGTCACGTCTAGTATCCTTGTGGTCTTCGTCAGGAGCGTGTGAGGATGCCAGTAGTG
CGGTGGCAGCTATTTTTGCGGCAAGCGATCAAGACGGTCGTGAACGGGTGATGATGTCACTGGAAAGCAATGCATTCATGAAGACACAGCGGCTTCTGGC
AACAAACCACGCTGAGTATTGGCGGAAACTACTAGCGAATGCTAGTGTTGACTTGGTGGCGGTCTTGACCAAATGCTGGGAGAGTGAGGATCTGGAGCCC
GATTTCCTTGGTGTGCTGTTTGGCGCGCTTggagacgaggaagaggtgatcaaggagcagcttgTGACCAAAGTAGCACAGTTCCGCCAAGACTGCGCTG
GGCACATGTACCGGTCGCTGTTTGGCTAGCGTCCTGCACCTGGTTCAACGTGAAGCCGTTACCCTAGGTTGAACCCGGCGCGCTCGACCACCGAAAAGCA
ACATGTTGAACCGCAGTGATTGGCCGACGTCGGTACCCGTCACCAGCGGGTAGATAGGGCTGTGCGTCTCAACAGCAAGATTAGCAGCGTCAGCGCAGCA
CGATTGAACGCATGTGATCCCAGACTGGGGTGCTTGTTCCTCAATCTCATTTCCCAattggcctcgtcctcgcaACCCAAGTATCGCCCACCGACATGAC
CAAGCGCACCACCTCCAACGACCCCGCCTTCGACGTCCCCATGGTGGACGCCAAGCGGCAAGAGAAGCTCCAGTGGAATGTGCTGCCGTCCGACTTCTCG
AAGCTGTGCTCCAACCCCATTCGGAAGATTGTCGACAACATTAAGAAGCCCGCGACGTCGACCAAGACTCTGATcccgctgtcgctgggtGGGTATCCAA
TACTTGCGATCTCGAGTTTTCGGGATCGGTACACTAACGTTCCCTTGACTGATTATGGCGTTTATATAGGTGACCCCACAGTGTTCGGCAACTTGCACTG
CCCCGATGTCCTGGTTCAAGCGATCGTCCGCAACACTCGGTTAGTGGACTGCAACAGTATCACTTGCACCTTTTTGTGTAAGCTGGAAACTAATTCCTTT
TGTTTTCTTTGCCAGTTCAATGCAACACAATGGCTACATCCACTCCGCTGGCTCCGaggcagctcgtgcagcaatTGCGCAGCACTATGGCAACGTGCGA
GCTCCGTTGACGATGGACGACATCATTATCTCCAGTGGGTGCTCGGGTGCTATCGAGATTGCTCTACGAGGCCTGCTGAACCCTGGTGATAACATCCTGC
TCCCCAAGCCTGGATTCCCGCTGTACCAAGCACTTTGCGAAGCGCACAACGTCGAGTGCAGGTTCTACAACCTCAAGGTAAGATTACCACAAGTTCAATC
TCCTTTGTGGTGGGTACGTGTATTGATGCATTGTGTATTTTGGTGGGGACAGCCGGAGAGTAATTGGGAAGTCGACCTGGAGAACATGCAGTCCTTGGTG
GATGACAACACCAAGGCTATCCTAGTGAACAACCCGTCGAACCCATGCGGCAGCGTGTACTCGAAGGTAAGGGATGCGAGCTATCGGTATTGCGAATTGT
CATGTGGACCTCCGTATCTGATGTTTGACCGTTCGACTTTGTCATGTAGCCCCACTTGGAGAAAATCCTTGCTTTCGCCGAACACAACAAGATCCCCATC
ATTGCGGTAAGCTGGCATTCCTTCAAAATGTAGGAGGTCACTTTTCTAACTTGTATCACTCGAATTCTAGGATGAGATCTACGGTGATATGGTATTCGGA
AGCAACGTGTTCTTCCCCATGGCTACACTGACGAAGACGGTTCCCGTGGTGGCGGTGGGTGGCCTGGCCAAGCAATTCCTGATCCCCGGCTGGAGAGTCG
GCTGGATCATGGTGCACGACCGCAACAACATCTTGAACGACGTGCGCACCGCGTACTTCAAACTGTCGCAAAATATCCTTGGGGCGAACTCTCTAGTCCA
GGTAAGATCTTCTCTTCACTGGCGACCGGTGTTAAGACTTGAGCTCacgtgctgttgctgatgaCTGTCACCAGAGTACCATCCCTGATTTGCTGACACC
GGTTGCTGGGAGTGCCGAAGAGCAGTCGCTGTTTGACTTCAAGACGCGCTACTTCACAACGCTGGAGGAAAATGCCGAGTTTACCATCGACACCCTGATG
ACGATCCCAGGTCTGGAAGTGGTGGTCCCTCAAGGAGCGATGTACGCAATGGTACGTAGTACTGCAACGCTGGTACCGGATATACCATTTCAGCAAATTC
ATTGTCTGTTGTTTCACTACTTTGCAGGTAAAAGTCCGAACCGACGTTCTTACGAAGATCAAGGACGACTTCGACCTGACGCAGAAACTGCTAGATGAAG
AGTCTGTTTTCGTTCTGCCCGGCCAGGTAAGCTACCGTCGATTGTTGATCAAGTTGCCTGTGATGCTACGTCGACTAACCTTGCTCTATTGTGCTGTTGG
TAGTGCTTCGGAATGACCAACTACTTCCGCATCGTTTTCTCGGCGCcgcacgaggtgctggcggacgccTACACTCGCCTCGCCACCttttgccgccgcc
accagtGAACAAGGTCACCTTCAAGACCTACTTAATGAAGTTTGATAAACTCGTTAGTGAATATAAGTGAACATTTTGTCTCGTACACGTGCCAATGCTT
TGTTCCATGGGTGCTGGTAGTAAAAGAACCTTAAGCTGGTGGGGCCTACCTCACATCAAGCGAGACCAATCACCGAGAGGCAACAAATGGTACCGATTGG
CCACTACGGCACTCGTCATGGCGCTTCATTGGTTGGTAAGCACGGCGCTGGTAGCTACCATGCTCACTACAATATAGCAGATCTAGCGCCTCTACAAGGC
AGCAGTGCTCGTTTGGGTGTCGCCTCCAGCcttcacctgctgcgccagcctGTCCGTATCTGAATAACAACAACACGAGCAGAACAACGTCAGACTAAAG
AGCAGCATATACTGAGGCACGATGCAGGAAATACACTTACcagctttcttcttggccgcagcAACGCCAAGGGCGATGAAGACAACCGCCATGACGGCCA
GGAACACACCGACGCCCACGAAAATGGTCTGGGGGGCCGATTTTGAGCTGCTCAGAGAAGCGCACGTGCTAATATCCTTAACGCTGCAGTCGGTGCCCGT
GTAGCAGGAGAGGCAGCTGCACGACTTGGTGCCGTTCGATTCCTTGCATTGGCCGTTGCCACCGCAGTCGGATGTGGTATCGCAAGTACCACCACCGCTG
GTGACCTCGTACGTGCCGCAAATTTTCTCCTGAGTCGTACCAACGGAACTGCTCAAGGTCACATCACACGTGTCACCACTGTCCGTGCAGATCACGCCCT
CACGGCTGGAGCAAGTCCacgagtcggagctggaaATCTTCAGGTTGCtcgccgagcagctgctcACGATCCAGCCGTACTTGGTCGCCGCCGTGTTGGT
AGACTGTGTCTTCGTTTCCACGGTAGGCTTCCACGTGCATATAGTGGTGTCAGTCCACGCTGCATTGTCCGTGTAGCCCGAGTATTTGGCAAACATGGCC
TTCAGGTTCGTGTAATCCGTCGTGGACTTCGAGCTGGGCGTCGACAAGAAATCCGTGCTTCCACCTACGGATAGAAAGTCAGATTATGAAAATGAGCGAT
AGCAAAAGGCGCGCAGCAAGTGTACCTGTGAACATTGGGAACAGCGAGTCCGACGCAAGCTTGGCTTCACCATACGAGTAAGCCAGACCACCAGACCAAA
CGGCCGTAAACTCCTTGGTCTTCGAGGGCTcttggtacatgtacggaATCATTCCCCAGTCGCGAGCTTTCGCAGAAGAAGTCTTACAGCCATACTCGcc
gaaggcgacgacgatgggGATACCCTGCGCCATGTCGATGTAGCGCTGGTACGCCTCGGCGAACGTCGAGTCGACACACCAACGGTACTCGTTGATTAGG
TAGATATCGATACTCTCCGCCATTAAACCGTTGGTCATCTTGTCTCCGCAGAGCAGTCCCTGGATCTTAATCACGTGGTAGTCGTCGGCGTTGGAGACCT
TACCGTTACTActgtcggcagcagcgtagGCGAGCGGCAGAATTCGgatcttcttgccgttgACCGTCATCCAATTCTTCAGATCGGACACGTAGGCCTT
GACACACGAGCCGGCCGTGAGATCGGCCTGCATGATTTCGTTAGCCACGACAACACCCAGCGTGTTGTCGTACTGGGCGAAGTTCTGGAtgatcttcttg
ccgtactctagcagcagcgccgggtAGCACGTCTCGGTCTGGTCCACGGTcttggcgccgtcgcccgaggACACTTTCCCGGAGcagctcagcttcttgg
tgatggTCGAGTAGCGGTACTTGCCATAGTAGGCGTCGTTGTCGGGCGAGGCCGAGACCATGACGTAGACGCCGAGGTCGGCCATGTCGTTCATGAACTT
CTTGTACGAGGACGTCGGGTTGATGTTGTACAGACGCAGCGTGTTGTACTTGAGGCCCGCGAGGTTCTCCGCGATGATGGCCTTCGAGTACTTGTCGTAG
TAATCGTCGCTCACGGCGTACTCGTACGTCATCTGCGTGGCGCGTACGATACACAGATATTAATTAGCCCCTCTCTATTGAATATGGCGCCGAGCAGTGC
TTTGCTGTTAGCGTGTCCGGCCGCTGGCTCCTTCCTATCCTTGTGAACGCACCCCTttgatgaagaagcgcgcgccCGTCTTGGCGTTGTAGAGCTTGTT
GCCGCGCACGACGATCACGCCGTCGACGGCCGCGCCCACCGCcctgtgctgcagcagcgcgagggccgccagcacggccagcagcaggaagcttCGTCCG
GTCATGGCGTCCGAGGTAGGTGCGAGTCAGTAGTCGTGGGCAGTCGCCGACTCCGTTTCCGCTATGGCCGGCGGCCTCGAACAGAAATTTCCGCCCGAAA
TTACAGCTGGTGCACCCATAGTCATATAGAGGGGTCCATGTCAGTGATAGTGTATCGGCTATTGGGACTGCACCATACTGAAAACAGCTGGACCTCTTGT
TTCGAATCGTTTTCATGTTGATAGAGGATTCAAGGTTATCGGTATTCATAACGTGCGTGCGATTTGGCAGGATCGCCGATTGGACGAAATTACCATGTCT
GCTTATGATTGGTCAAGAACGATTGCGAATGCAGTGTCTGCTACTTTACCCACTCGAAATACTGTACCCATGTGAATAGCATTACTAGGGTTTGATAGTA
GTGGGGATTTCAAGGATAGTACTATTACTAAGGTAGATATTGTATTTTTTTCTATTACTAGTCTTAGATATAATATCTGCTAAATGTACATTAGTACTCA
TActaatatcactactaaGTCGTCTATTCTACCACTATTCTCCTGCATATCCTTTTGCGACATTAACCGGGTTTAATTATTTACCCCTCGGTGAAAAGGG
TTCGTCGCTGCAGTGGGGTTAATTCAAAAGCTCACGAGCGCCATTCGCTTATTGTCTCCAAGACTCAGCACCAACTCAAGTCCGCCGCCATGCCGCCCAA
GGGAAAGAAGACCGACGAGGTAAATGCCCGCTCCAACAGCCCCGGACCCCCTCCCTCGCTCGCTAACTGTTACGCTCTTCTTCCGCCCCTCCCTCCACCT
CCCGCCAGCCCACGCGCACGTACCTGGGTCGCCCCGGTAACAACGTCAAGATCGGCATCGTGGGCGTCCCCAACGTGGGCAAGAGCACGTTCTTCAACTG
CCTGTCGAAGCTGCACATCCCCGCCGAGAACTTCCCCTTCTGCACCATCGACCCCAACGATGccgtggtgccgctgcccgaccagcgcttcaactggctc
gtggacaagtaccagcccaccagcgtcgtgccgcccgtcatctccatcacgGACATCGCCGGCCtggtgcgcggcgccgccgaggGCGCCGGTCTGGGCA
ACGCCTTCCTGTCGCACATCCAGGCCGTGGACGCCATCTACCACATGGTGCGCGGCTTCGACTCGACCGAGGTGACCCACGTGGAGGGCAACGTGGACCC
CGTGCGTGACATGAAGATCAtccaggaggagctgcgtctcAAGGACATTgagcgcgtcaagaaggagtcggccggcgtcaagaagctggccgagcgcggc
gtcggcggcaaggagaagaaggtcgagTACGAGTCGCTGTGCAAGATCCTCGAGTGGCTCGAGTCGGGCAAGGACGTGTCCTTCGGCACGTGGACGGCCC
CCGAGGTCGAGATCCTCAACAccatgcagctgctgactGCCAAGCCCGTCGTGTACCTCATCAACGTGAGCAAGCGCGACTACCTGCGCAAGAGCAACAA
GTACCTGCCCAAGATCGCCGAGTACATCAAGGAGCGTGGCGGCAACGAGCCCGTGGTCCCGCTCAGTTGCGagttcgagctcgagctgctcgacctcgAG
GCCGGCGGCCAGCTGGAGACGTACTTCAAGGAGAACCCGACCCACAAGTCGATCCTGaaccgcgtgctccgcatGGGTTACCAGGCGCTCGGTCTGGTCC
ACTTCTTCACGGCcggcaaggacgaggtgcGTGGCTGGACCATCCGCAAGGGACGGCTGGCACCCCAGGCTGCCGGTGTCATCCACACGGACTTTGAGAA
GGGCTTCATCATGGCCGAAGTCCAGGCGTTCGCTGACCTGAAAGAGCGTAAGTTTGGCATTAATCGTGTGCTGATTGTTCCGTTTCCCAAGCTTAACTAA
CGTTTACATGCTGTTGATATCCTGCAGTGGGCACGGAAGAGGCTGTCAAGAAGGCtggcaagctcaagcagcagggCAAGAAGTACGAGGTCCAGGACGG
CGACATTATTTTCTTCAAGTTCAACAACTAGGTGGATTGACTGCCTGTGGCGTTGAGTAAGTCGAGCAACCGTTGCGTCGAGGCCTCCGCTATAGCTACC
AGTGGGTTGTGGTTTTGAGTGCCCGTTGCAGATGATGTCTACACATCTACAGCATGCGGATTGAAGGGCGCGATTGCAGAGCAACCCGCAATGAAATAAA
GCATGCGCTTGAACACAATGGTGTGTCAAGCAGGAGTTTATGCTGGATGCCCGGATTGATTGATGCTTGTATTTGTTTGCCAAGCAGGATTAGCACTAAC
GGATACGGTGAATCTTGGATCTGCGCAACCCGTCGCGCCCCTTGAATGGCGCCTGCCTGGGTGTGGCCGACTGATCGCGTGGAGTTTCTCACTGTGTGCT
CCTTCTCGGATACTGCCAGAGGCGAAGGAGCGATAGCATTTGGCAGGGGCAAAGCAGGAAGTCGAAGTCTTGGGAGGTGATAGCGCGAAAAAATTCCATC
CGGGAGGCAGGTTCCAGTCTAGGCATACCACCCCACCCAGGGCAAAGTCGCCGGAATGGTGCGTCACGTATTGATGTGGGTCTGTCGGGTTGAAGAGGCT
TCTTGATAATGTGCTTCAATGTTCACTTTTGACAGCCGATCGGGTATGGATGCGAGCCAGAGCTGGCGTGGATTGCACCGAAGCAGAATGGAGAGATCCC
TATCAAGCGATCCGGACACTCTTTCACCTTGAAGAGCTCGGAGTCAGAGACTGCCATCTACATGTTCGGTGGGTGCGATCACAAGTCGCCTCCAGGACCT
ACCAACGAGCTCTTCCGACTTGACGTCACAAATGGTATCAGTGCGAAGTAGCAAACGCATGGCATTTCAAATCTTGCATAGACTAATGTAGCGATGTTTG
CTTGCTGGCAGGCTACACGTGGTCCAAGGTAATAAGCTCTcagggcgacgacgatgtaCCAGCACCTCGATGGAGGCATTCCGCCATTTTATTCGAGAAG
AACATCATCATCTTCGGCGGCTTCGCGGCTGAAAAGCGAATGAACGACCTCTGGATCTTCAACACCGAGTTGAAAGTGTGGGATCAGAAGTATGCCCAGG
GCTTCTGGGAGGGGCTGCCGCAGTGCCGCGGCGCACACAGTACCACACTCATAGGCGAAAAGATGTACGTGTTTGGTGGCTACGGCGGCAATGGTTTCGG
TCGTACCGACTTCAACGACTTGCACGCGCTAGACTTGCACTCGCTCAAGTGGCAAGAGATTCAAACTGAGGGTGAAAAGCCTGAACCACGCTCGGGTCAC
CAGACATGCTTAGTCAAAGAACAGTTGCTGGTCATCGGTGGTTGGAACAGCTTCAAGCAGTTCCAGGACATCTTTGTTTTCGATTTGCCAACCAAGACTT
GGAGCTTGTTGGACACACCTCTTCCGTCGCCCATCTGGAACCACACGTGTGTGAGTGTTGCAGCTGTGCCTCACTGGAAAGTGTTCTTGTTTGGAGGCAA
CAGTGGAGATCTAGCTGAGTCTGGAACGGCGCAAGGAGTGTATCTGAACAGTACGGCGGTCTTAGACACTGGCAGCATGGTATGGCTAAACCCTCCCGTG
AAAGGAGAGCTCCCAAAGGCACGTGCTGATACTGCGATGGTGTTCGATTCCAATGCCAATCACTTGATCTTCTTCGGAGGGTGGGCAAACCGCTGGTATA
ACGACTTGCACGTTCTTAATGCGAGCGAGATTGTTGGGCCACCGTACTCAATTTCATCGATCGAACCGAAGCAAGGACCGATCACAGGAAACGCCAAGGT
GAAGATCACGGGTTTCAACTTCACAGGTCAAATCGCAACTCTACGCTTTGCGGTTGCCAAAGGGTCAGTCGATGTTACTGGAACTGTACTCAGCCCTACC
ATTCTTCAAGCTACTGCGCCCAGCTTTGAGAAATTTGGCCCCATGACTTCAGAAGTTCGGGTGTCCATGTCAGGAGGCATGTACACGAACGTCGCCACAT
CATTCCAGTTCCACTCGGTCACGGCAGCCCCGAAGTCGCTTGCCTTTGGCCCATGTCTAATTGCTGCACTGAGCGACAACTGcttggccgagctgccgAC
TACGTTTATCATTCAGTCTCGAGACAAAGATGACAACCCTCGCGACTGTGGAGGGGACGAGTTTACTATTACTCTGAAGAATTGTGACGAGCCTCAGGCC
GAAATGGAGCAAGTTGCATCTATCCTCGACAAGAACGATGGCACCTACGTTGTCACATTTACTCCACCCCAAGCTGGCAAATACGAGATCTCAGTCGACT
TCACTGGTACATTCAGTGGCATTGCTGGCCCCATCCGTGGTTCACCGTTCACCGCAATGTTCCAACCCGTCACGGATGAGAATAAAACAAAGTGTCTGCC
GCCGCTTGCCACTCAGAAAGACTTCGATTCTCCAGACTTAATTCGTCGTATGATGGCTACGATGAACACACGCAACGGCGAATTCCGCCGTATTCTTGTT
GATCTGCGGAAGGACATCCCCAATAACGAAACAGACGGACTCGAGACCCTGCGGAAGGTCAAGGAAATCATTCGCAAGCTTGAGACAGAGAAGGCGACGA
ACCACTTAATCCTCGACCAAGTGCGACAGCTTTTCTTCAATATCAAGAAGAGTGGCGGCCATGTCGACAAAGAGTTGGTAGAAATCGAGAACATGGAGAA
GCTTTTCGTTGACGTCGAGAAGCAAATTCCGGTCACTGAGAAGCGCGTCCAGGAGCCAACGCGGGTATTCAGCGAGAAgaccgaggagaagatcgtAGCA
TATGAGAAGATGATCACTCAAAAGATGGAGACTCTGAAGACTCTGGACTTTTggtcgtcgaagctggagccTGACAAGGGCCTGGAGAAGATTGAGAGTT
ACCTCCTGGACTGGAACATGGAGATGAAAAAGTGCGAGGAAAATACCAAGTTGTGCTCCATCTTTGGGTTCCCACAGCTTATGAACGAATCGCTTCGCAT
GATGGGTCTCATGCacgcagatgcagatgcgATGAAGACCGTTTGGGCCATCATCAAACGCGCCAAAGCGTTCTTCAAGGCAACTCAAGACTTTTTGTTC
AAAGAAGTCGATGTGAATGCGCTGCAGATTGAAGTACAGTCTGCGTTGAAAGAGCTCAAGAGGATCCCTAAAGGTATCCAGTGGAGTGATGCGTACACTT
CCATCTTGAAGGAGTGTCAAGCCTTTGATAAGACACACCCGATCATTCGATGTGTGTCATCGAGTTACATGCGCCCGAGACATTGGAAGCGTATCATGGC
TCACACGGGCGAGTTTCCAACACCGGACGAAGACCCCGAACAGCGACTGTCATTGATCCTGAGCAAGAACTTGTTCAACTTCAGCTCGGACATCAATGAA
ATTTGTTacgaggcggagaaggagcaagagctcgagcttcggttgatcgagctcgaggctCTGTGGGCTGAGGTGAACTGGGAAATGACTCCTTACAACC
CCGGTGCTTCGGAAGAAGACATCGTTCCTCTTCTGAAGGTGTCTGAAGAGAACTTTGAGCTCCTTGAAACTCATCAAATTGACGTACAAGGCATGAGTGC
GTCACCATATCAGTCAGAGTTTGAGCCTCGCGTTGCAAAGCTTCAGATCGGCCTTTCGTCTATCAACGAAGTTGTGCTtctgctgggcgacatccAGCGC
TCCTGGAGCTACTTGGAGCCTCTGTTCATTCAGTCCGAAGAAGTGAAGAAGCAGTTGCCCGAGCTAACATCCGACTTCGAAGACATTGATCGAGAGGTCC
GCCAAATCTTAAAGACTGCTTTGAAAATGCTTAAAGTGCAGCAGGCATGTACGGAACCAGGTCTCATTAAGCGACTGGAGATGATTGTGGAGAAGCTTGA
GCTGTGCAAGCACCGCCTGAAAGAGTTCCTCGacgggcgtcgtcgccagtTCCCGCGTTTCTACTTCATGTCCGAAGCAGACTTGCTCGATATTCTCTCC
AACGGATCACACCCGGACCGTATCATGCCGCACTGCTCTAAAATCTATCTGGCAACCAAGACTCTCACCCTCGTGGATCGTGGACCCGGCGAACGGCCAG
TCGCTACATCTTTTGTGGCTGGTGTGGGTCACGAAGTTGTCGACTTCTTTGAGGCCCCGGTGCTCGAGGGGGAGGCAGAGATTTATCTGGAGACGATCAT
GCGTGCCATGCGGCTGACGCTTTTCAAGCACATTGAACGCTCGCTGGTAGCCTACACTGAAATGCCTCGGGTTGAGTGGATTAACTTCAAAGATGACACG
AACAAGCCCATGGATGCAGCCCAAATTATCCTGCTCGCAGCAGGAGTGCACTACGTTCAAGAAGTTGAGCGTGCTTTCCGTGGTATCCAGGGCGGCGATA
AAGATACCTTGATAAACTACAACAAgatgcaggagaagcagctaGAAGACCTGATTAAGCTCACACAAAGTAACATTTCGTATGCAGAGCGACAGCGTGT
GATGGTGCTCATTACGATGGATGCCCACGGTCGAGATATTGTGGCAAACATGATCCGTGCAGGAGTGGAGGAGGCAACGCACTTCCAGTGGCAGTCGCAA
CTAAAACACTACTtctcaccagcagcaggcagtTTCCTGAAACGTGATAGTACCTTCCGTGGAGCGAACAACGCTCGAGCTCAAATTTTGATCTGTGACG
CTGGCATTCCGTACGACTACGAGTATCTCGGAAATGGTCCTCGACTTGTGATTACCCCGCTGACGGATCGAATCTACGTGACGGCCACACAGGCGCTGAA
CTTGCAGATGGGGTGTGCTCCTGCTGGCCCCGCTGGCACAGGCAAAACGGAGACGACCAAGGATTTGGCGAACGCGCTGGGAAAAGTGTGCTATGTGTTC
AACTGCTCGCCCGAAATGGACTTCAAGAGTCTAGGAAATATCTTCAAAGGACTGGCGTCGTCCGGTTCTTGGGGCTGCTTCGATGAATTTAATCGACTCG
TGCCAGAAGTGCTATCCGTGTGCTCTGTCCAATTCAAGGCTGTGTGCGATGCATGCAAAGCTGATGACGAGAAGTTTATCCTGGAGAATGATGGGGTAAT
GCTAGACCCGACGGTTGGAGCATTCATCACGATGAACCCCGGTTACCTGGGACGCTCGGAGCTGCCTGAAGGCCTCAAGGCATTGTTCCGTCCCATGACT
GTCATGGTGCCCGATCTGGTGCTAATTTGCGAGAACATGTTAATGGCAGAAGGATTCACACAGGCCAAGATCCTGGCATCCAAGTTCTACGGCTTGTATT
CGTTGCTTGGGCAGCTCCTGTCCAAACAACTTCACTACGATTGGGGGCTTCGAGCTGTTAAAAGTGTGTTGTGTGTCGCCGGTGCGTTCAAGCGCGCGGA
GCCGGACATTCCTGAGACGGATTTGCTCATGCGTGCGCTGCGAGACTTTAACATCCCCAAGATCGTTGCAGAGGATATGGTCGTGTTCTTCGGTCTCCTC
GGAGATCTGTTCCCGCGTGACAGTCCTAATGTAGATGTACGTAACGATCCTCCACGTAAGCGTGATATGGAGCTTGAATCCATGGTACAGGGCGCTTCAG
AAGCTATTGGCAACACACCGCGGCCAGAGTTTATGCTGAAGGTTGTGCAATTGTCCGAATTGCTTGCAATTCGGCACTGCGTCTTTGTGATGGGCCCCCC
GGCGTCTGGCAAAACGGAGACGTGGAAGACGCTGAAAAAGGCTCGCGAGATCATGGGCACGCCGATGGAAGTGCAAGACCTGAACCCGAAATCGGTGAGC
ACAAACGAACTGTACGGATACATCGTGCTGAAGACGCGTGAATGGAAAGATGGCCTGCTTTCGCGTATCATGCGTGACCTGGGCTCTCGGCGCCGTGATA
ATGGTGACGAAGATAACAACCCCAAGTGGATTATTCTGGACGGCGACCTCGATGCTAACTGGATCGAGTCTATGAACTCTGTCATGGACGATAACAGAAT
GCTTACCCTCGCCTCGAACGAGCGTATTCCACTGAAAGTTCACATGCGGATGATCTTCGAGATCCGTGATCTTGTGTATGCGACACCGGCTACCGTGTCT
CGAGCTGGTATCCTGTACATCTCAACTTCGGAGGGATACCAGTGGCGCTGCATGATTGACAGTTGGCTAGATCGACACTGCCAACAGCCTGTCGACCACC
GTTTGCGAAACATGATGTTCACTCCGGACACACGTGGCAAATTCCAGGGGCTTTTCGATCAGTACATCGAGACAACGCTTCGATTCTTCCGCAAGAAGCT
TGTCCCCGTTGTCCCCGTGGAGGAGACGACACTGGTGACGAACTTGTTGAATATGATCGACTGTCTGTTGACCCCTCAAGTGCTGGAAGACTACACCGTG
ATGCAAAATACATTTGTATTCTGTTGCGTGTGGTCATTCGGCTCCATCCTTACGATGAGTGACGATGGGACGGACTACTCGGCAGAGTTTAGCAACTGGT
GGAAGAATCAATGGAAGGATGTCAAGCTCGTGGCGTCTGCGAGCAACACGGTGTTTGACTTCTGGCTGGATCCGGAGACTTCCAAGTTCAACTCGTGGTC
GAAGAGTCCCTACTTCTACACGGAGACGTACGTATCTCCAAGTCCGATCAACCAGATTACTGTGCCCACCACCGAGACAGCATCTATTGCTTTCTGGCTC
GAGAACCTGATCTCAAAGAGCGTACCGGTAATGGTGTGTGGGCCTGCAGGTACGGGTAAGACGCAAAACATCATGGGtatgctgaagaagctcagcaaAG
ACGAAGCCACGGCTGCGTTCCGCTACTGCACCATCAATTTCAACTTCTACACCACGAGTGCCATTTTGCAGCAGACCATGTTCGGACAACTCGAGCGTAA
GACTGGTATCAATCTGGGCCCACCTGGCAAGGCACGACTCATCTACTTCATAGATGATCTGAATCTGCCCGAGGTGGATCCGTACAACACACAGAGTGCC
ATCTCGCTGTTGAGACAGGTGATGGAGTACAGGCATTGGTTCGACCGTATCAAGCTTCAGACGCAGAACATCTTGAACACGCAGGTGGTATCCGGAATGA
ACCCCACTGCAGGCTCGTTCTTGGTAGACCCgcgacttcaacgtcacTTCTGTACCTTTGCTATGGGTATGCCTGAAGCACCAAGTTTGGTCACCATTTA
CGAGACGTTCCTGGGTGGGCATCTGTCGAGTTTCGCGGACGAACTGAGCAACTCACAGTTCTCCAACGCGCTCATTAAGGCAGCGTTGAGCTTGCACGCC
AGTGTTGTGAGTACGTTCCGAAAGACTGCGGCAAACTTCCACTACGAGTTCAACGTTCGCCACTTGTCCAATGTCTTCCAAGGGCTCATCGCATCGAAGA
AGGATCGTTTCAACAGCCAGGAGAAattcgtgctgctgtggttgcACGAGAGTGAGCGCGTGTACGGCGACCGACTGGTGTGCAAGGCTGACATCGAGAA
GTAcaaccagctcgtgcagatgCAAGTTAAAAAGTCGTTTGCGTCGTGCAATACGAGTCGGTACTATGCGGCCGAGAACTCGTGGCCCCTCATTTTCTGC
CACTTCACGAAGGATGGAGACAATGAGTACGACCAGATCATGGGGACAAATCTGGACGATCTCAAGATGAATCTGCAAATCCAGCTGCGTgactacaaca
acaacgaaAACAATACTGCGATGCAGTTGGATCTCTTCGACGATGCTGTGAAGCACGTGGCTCGTATTGTTCGTATCCTGCGTAATGAGAGTGGACATGC
CCTGCTGGTTGGTGTGGGAGGTAGTGGCAAGCGTTCATtggcgcgcttggcctcgcaTATCTGCGGCTACACTGTTCGTCAGATTACAATCAGCTCCAAG
TACGGCGAGAACGAATTCAAGGAAGACTTGCGCAAAATGCACATGGCAgtggtggagatgctctcTCGCAACGAAGAGGATGGAGGCGTTGTGTTCATGC
TCACGGATTCGCAGATTACCAACGAGAAGTTCCTCATCTACTTGAACGATCTGTTGGCCTCGGGCGAGATTCCGGATCTGTTTGCGATGGAAGATATGGA
TAATATCGTCAACTTGCTGTCGCCTGTAGCTGGGACGAAAGACCGAAAGGAGGTCATCAAGTTCTTCCAAGCGGAGATTCGTAAGCGTCTCCACCTGTGT
CTATGCTTCTCCCCCGTCGGTGATGACTTCCGAAACCGTGCGCGCAAGTTCCCTGCACTGGTGAACTGCACGGTTATCGATTGGTTCCAGCCGTGGCCAA
AGGAGGCTTTGCTCTCTGTTGGTCGTGAAAAGCTGAAGGAGATTGGAGATTTGCTTGGATCCGATGAGTCACGCGCAGGTATTGAGACATTCATGCCGTT
CTCGTTCCAGTCGGTGAATATCTGCGCCGAGCGATTCTTCCAGGTAGAGCGCCGACACGTCTACACGACGCCGAAGTCATatcttgagctgcttcagctg
tACAAGAAGATTCTGCGCAAGAAAGTGGAGGAGTACGCTGCAGCCATTGATCGCTTAGAGAAGGGCCTGCAAAAGCTTAAAGAGACGGGAGATACCGTGT
CGCGACTTgaggtggagctcaaggTCATTCTTGAGGCTGCGGAAGACAAGAAGGCTGTGGCGTCCGGTATTGCCGAGGCTGTCAATAAAGAAAAGGCCAA
TGTGGAAACAGAAAGTAAGAAGGccggcgacgaagctgcaaAGTGTGCGATCATCCAGACAGAAGTCACGGAAAAGCAGCGGTCGACGCAGGAGGATCTC
GCAAAGGCCGAACCTGCTGTCGAACAAGCTATGGCTGCTCTTGACTCGCTGAACAAGAAGGATCTGGGCGAGTGTAAGACCATGTCGAAGCCTCctgctg
gcgtcgatgaTGTGTTCTCAGCCACAATGGTGCTGCTAGCGGGTGTGCACCCGAACGTGCAAGTCACCAAGACCGGCAAGGTGAAGGACGTCAAGTGGGA
CACAGCCAAGAAACAACTTCTTGGTAACATTCCCGAGTACATCGAGTACTTGGTTGGCTTCAAGCAAGTGGTGGACGACGGTAAGGTACCTCTCACCAAC
TGGAAGGAGGTGCGCGTGTTCTTGGAGatggagcacttcaactaCGACACAATCCTTACGAAGAACAAGGCTGCTGCCGGTTTGTGTTCGTGGGTGATCA
ACATTGTCATGTACTACGATATCGTTATTACAGTCGAGCCTAAGCGTCAAGCTTTGGCCACTGCTAACCTAGAGTTAGAGGCTGCTAATGCTCGTCTGGC
CGAGGTGACGGCGCTCGTCGCTGATCTACAGGCAAAACTAGACAAGCTGCTTGCggaagccgctgcagcggagaaggagaaggaagatgCCATCAACGCT
GTCGAAACTGGAAAccgcaagatgaagctggCAGGCACACTGACTAATGATTTATCGAGCGAAAACGTTCGATGGGGGATCAACGTGTTGCAGCTtcaga
aggagaaggacctgctggtgggcgacgtgctgcttgcaTCAGCCTTTATCTCGTACATTGGTCCGTTCACGAAGCCGTTCCGTGATGAACTGATTAACAA
GCACTGGGTGCCATACCTCCGGACTGCTGCCGGTGGCGAAAGCATAGCAATGTCCGAAGAAGCCAACCCGCTGCTCATTCTGACTAATGACGCACAGATT
GCTCAATGGAACACCCAAAAGCTCCCATCGGATCGTGTGTCGACGGAGAATGGAGCCATCGTGGTGACCACCGTGTCTATGGGTCGACGACCGCTTATCG
TCGATCCGCAATTGCAGGCTATCGCGTGGATCCGTGAGATGGAGGCACACAACAACCTCATCATTGTCCGAGTGGGCCAGAAGATGTGGATTGAGCGCCT
TAAGACTGCTATTGGTACTGACGGCGCCTTCATGATCGAGAACCTGGGCGAGAAGATTGACCCCATCCTGGCACCTGTGATCCAGCGCTCGACTtcgcga
cgtggtgctcggTACGAAATCCAAATCGGCGATGCTTCCGTTCCGTACAACGACAACTTCCACTTGTACCTGCACACGAAGTTGGGCAACCCGCATTACC
CGCCTGAGATCCAAGCGGAATGTACTATCGTGAACTTTACTGTCACAATGCTTGGACTGGAAGACCAGTTGCTGAACCTGGTCGTCTCGAAGGAACGGCA
GGATTTGGCTATTAAACGCGAAAAGCTGATCCAGGAGCAGAACAACGGCAAgatcgagctgaagaagctcgaggacgatATCCTCTTCTACTTGGCTAGT
GCCGACGACGATATCACGAACAACCAGCCTCTTATTCAGATTCTGAGCGACACGAAGCACAAAGCTCAGCGCACGCAGAACAACATGGAGGCTGCTAAGA
AGACGCAAGAGTCCGTGAACATCACGAGTGAAAAGTACCGTAGCATCGCCGCGCGAGGCTCTCTGCTGTTCTTCCTCATGAACGACATCAGCAAGGTGCA
CTCGTACTACATCTACTCACTGGCGTCGTTCCAGCAGGTCTTCTTGTCTGGGATCTATCGCGCCCCACCAGCGAAAACCCTCCTTGCCAACGAGACTGAT
GGTGCAGAAGGTGAAGCGGCCCCTGCAGCCGaggccgctgcagcaacagaaggtggagcaggaggcggcgatgaagaagctgaggaCAGTGAGCCTGCAG
TCCCAGACCTGACAGATGAAGAGATGAAGGAACGTTGCCAAGTGCTGATGGACAGTATCACCTCGTGCGTCTACAACTACGTTCGCCGTGGACTCTTCGA
GCGCAACAAACTCACGGTCGCGACAATGCTGTGCCTCAAGATTTTGCTGAAGGACGGTTTGTTGAATGATTCCGAAGTCGAGTACTTCCTCATCAGCAAG
GCTCATCCGGATGCAGGCAATGCTGGGTCGGCGTCCGAGTGGCTCATCGCAGCCATCTGGGCAAAATTGAAAGCGCTCGAGAGTGCAAAGGCGTTCCAAG
GACTGGGAGATGCGATTCAAAACGACCCGGACGAGTGGCGCAAGTGGTTTGCTACAGAAGATGCCGAGCGACAGAAGGTTCCTGGCGACTTTGTGAAGCT
CACCGCTTTCCAACGATTGATACTGTTGCGTGCCATGCGACCTGATCGAGTTACGAACGCATTGCGAACGTTCATCCTCGAATCACTAGGCGAAGAGTAT
GTGACCCAGCCACCGTTCAATATGGAGACGACATATGCCGAGACGAACTCGAGCATTCCGATCTTCTTTGTGCTGTTCCCTGGTGTGGATCCGACGCCAT
GGGTCGAAACGCTCGGCAAAGCGAATGGCGTGAGTCTGGAGAACAACAACTTTATCAACATTTCCATGGGGCAAGGCCAGGAGGCATACGCAGGCGAGGC
ATTGAAGCGACTGAGCACGGAGGGCGGCTGGATCATCCTGCAGAATGTGCACTTGATGCAGTCGTGGTTGCCGACACTAGAGCGTcagctggaagaggtg
gCTACTGAAGGTGCACACGATCTCTTCCGATGTTTCATCTCTGCCGAACCGCCCCCGTTGCCCGACATGCTGAACATTCCCGAGTCGTTGCTTCAGAGCT
GTATCAAGGTGGCTAACGAGGCACCTTCGGACATCCAATCCAACCTACGTCGTGCTTGGGCTAACTTCGGCGAAGACAAGGTGCAGGCTTGCACTAAACC
GGCAGAGTTCAAAGCTTGTTTGTTCGCGCTGTGTTGGTTCCACGCAATTGTGCTGGGACGACGGCGATTTGGACAGCAAGGCTGGAGCCGAGCATACAGC
TTCAACACAGGAGATCTCACTATTTGTGCCAACATTTTGCATTCGTACCTGGACAACAACGTCTCAGTTCCGTGGGATGACCTGCGCTATCTGTTCGGTG
AAATCATGTATGGTGGCCACATCACGGATGCCTGGGATCGCCGTACAAACAACACGTACCTGACCGTTCTCGTTGACCCGGGACTACTTAGCGGGATGGA
ACTCGGTCCAGGCTTCAAGTCCCCGAATCCACAGGAGTTCTCGTTTGCCGACTACGCCAACTACATCGAGAAGAACATGATTCCGGAGGCACCGCCGCTC
TTCGGGCTTCACCCCAATGCTGAAATCGGATACCTCACCACGACGTGTGAAACACTGTGCTACACGATCGTGACTATcgggggcggcgctggtggtggcg
gcggcggagaggaAGGAGGCGGTGGTGATAAGACGGCAGCACTGCGGGCATCCATCGACGATCTGGAAACTCGTTGCCCTGAGTTCTTCAACATGCTTGA
CGTTGTGGAGGCCGCAACACCTCATTTGACTGAAGATCACGGCCCCtttgtggtggtggcgctaCAGGAGTGCAGCCGAATGAACGTGCTACTGCAGGAA
ATCCGTTTATCGCTTGGTGATCTGAAGAAGGGTCTAAACGGACAGCTCAATATGTCACAAGCGATGGAGGACTTGGCAACAGCAATGTCGCTGAACGAAG
TGCCTGGACGCAACCCATTCTCGCAGTGTAAGTGGGAGAAGAACGCTTGGCCGTCCACGAAGTCGCTGAGCGGCTGGTTCGCTGACATGGTGAAGCGCCA
TGAGCAGCTTGTCATGTGGACCGGTGACACCACGGGAGGAGGCggaagctgcttcgtcaCCCCGTTCTCGATCTGGCTGCCAGGTCTCTTCAACCCCACA
GCCTACACGACGGCATGTCTGCAGGTCACATCTCGTAAGCGCTTCATGCCGCTTAACCAGATGACAGTGGAGACCCACGTTACTACGATCCAGGACCATT
CGACCGTCTCGCACTACCCAGATGATGGTGTATTCGCGCACGGACTGATCCTGGAGGGTGCTCGCTGGAGCACGTTGGACGAGATCAATGAACGCTATCC
AGTTGGGGCGACGCCGCCTACCGAGTGCGGTGGGACACTGCTGGACAGTAaccccaaggagctgctctgGAGCATGCCCGTCATCTACGTCAAGGCCGTG
ACCACGTCCCCAACCTGGGAACCTTCTTCCGTGGGCTACCTGCGTCACGACCCGAACGTGTACGAATGCCCGGTGTACCTCACGCGCTTCCGTGGCCACA
CGTACATTTTCttggcgacgctgccgacCGACTGCGGCAGTGCCAAGTGGGTTTTGCGtggcgtcgcgctgctcttccaggaCGACAACTAGTGGTGGCT
GTCTCTTGTATGTATGAATACGTTCCCAACAACCGTTAGCAGcaaagagagagagagagaaagagaTGcatgtaaaaaaaaaatgaatAAACACCCTGAC
ACAGGACAAATGTACCAAACCTGGTCCAGAGCTCTCATGCCAGGTCTTCATTTCCCGTctgcctcctcttcctgcttcTGCAAGGCCAGCATCCTCTCCA
GGAAGCTGCCGTCATTGGGGATCTCCGGGACATCTCCAGGCGTCTCCGGGatctgctccatcttctccttcttctcctgcttctcttcctcttcctcgtg
caCCCcatccagcgccttggccttggctCTCTCCttgcgtcgccgccgcttctCCGCGCGCTTGTGCATCttggcctcgaactcgtcgacgctgcgcttg
cgcttggcctcgaactcgcgctgcgcctTGTTCTCCTTGTAGCGATGCTCCATggccgccacgcgctccatctcgctgcgGAAAACTCAGTCAGCAACCC
ATCGCATCACTTGGCcgagcaccgccgccgccgtacCGTCTCCTGGAGGCGCGGTACGTGTGGaactcgccgctgccggcgccCGCGGAGCTGCCGGACA
CGTTGTCCACGCGGTTGACGTGGAGCTTGCCGCTctgcgcgtcgctggcggcagGAGCAGACGGCtccgctgcggcggcggacgccCCGTCGTaggccac
ggcggcgcccTGCGCGTCCTGGTCGCTGAACGTCTGCACGGTCGTGTAGCGGCCCATATTGGTTTTGATCCTGCGAGTGCGGACGTCACTGAAGCGGCTC
GGCATAGGCACTCTACCGAGGGGGGTGATTCAAACCGGTACAGATGCAGTAATACCGTTGCTTTGTTACCGTGGTGACGGGTGGTCTCCAGTCGGAGCAT
TCTGGGGCCAGGAGCAAGCGGACCGTGTATCGAGCGCGTCGCCGGCAGGGAATCATGAGCAAGATCGCGCAGGCCTCCAAGGTGGCGTGgcacgtggtgg
acgccaaggGGCAGGTGCTGGGCCGCCTGGCGTCGCAGCTGGCGCCCATCCTGCGCGGCAAGCACAAGCCCACGTACGCGCCCAACGTGGACTGCGGCGA
CTTCGTAGTGGTGATCAACGCCAAGGACATCGTGCTCACGGGCAACAAGTGGAACAATAAGTTATATCGCTGGCACACGGGCCACCCGGGCGGCCTGAAG
CAGCGCAcggccaaggagctgttcgagcgcaagcccgaggaggtgctgcgcaaggccgTGTTCGGCATGCTGCCGCGCAACCGcatgcgcgcgctgcagg
accagaagctcaagatctTCATGGGCGAGGAGCACGACTTCGTGGGGGAGGTGGGCGAGAACCCCGTCATCCTGTAGGCCAGACGCGATATAGAGACAGA
GGAGCACAGAGAGGAAGGAAGGACGGAGGACGGACGGCCGTGGAGAACAGGGAGGGAGGAATACACGACTGTTGTTCGCCTGCTGCAACGGCCTCTTTGT
GTGATGCTATTGTGCCCTTCTTGTTATTCTACTGCAGGCTCGTTGTTTTCGttctcttgctgctgctgtcgaaggAGTGTGCgctcctgctcttcctgct
gacgctgcagttcgaGTTGCTCCTGAAGTTCGCGTTCTTTTCGAGCCTCGTCTTCCTGGAACCGACGGAGGAGAtcgtcgctcgtgctcaTGGCGGCGAG
CAGAGCCTCAATGTCGACAAACGCCGACTGCTTCATGGTGAAACCCGCCGCAATCTGTTGTTGTCAATGAGCAGGAACAACGAGTTAGTATGAATGGGAT
GGGAATCGACGGCAATGCGGGGTATCTGTCACCTCTGCGACGACGTGTGGGGGACATCGACGCCAGACTCCTGGAAGCACATCCGGCAGCGATGTCAGAG
CTGTTATTGACTCCACTACAGTGATGAGGGGGAGGAGCCCGGTATTGCCACTGCTCTGAGAGGTCAATGCGTCTCGAAGACGATCACGTTGGCGGGGAtt
gagaagcagctcgtgtgtTTCTTCAATAATGGGCGGTGCGTCTGGGGGGCTTCGAGGCAACAAACGTCTGCCCGTATCGACGCGCACCATTGTATCTTCA
CGCAACTGCACCGTTGTCGGGAACCGCTCGATGAACTCAGGCTGCAGGTATTTACAACATGCAAAACAAACAATTGATTAAGACAAACCTCAATCGCACC
AGAGCAAGAACACACGTACGCTGACGTCAAGGAAGGATGGGAGCGCGACTTCAGCCTCAACAGCGGCTCGGACATACTCgaccaccgcagcagcagccac
ctgCTCTCGATCTTTACGGTCCTCTAAAACACCTCTCAAAGTGATCTCGATGGAGCGCATTGACCGCGTAATTTCATCGCAAGCTTTCTCGGTAGCTTCT
TGAAGGAAGCGTACCCGCCGCCCCATGAAGTCGTGCTCGTACTTGATCCCGTTCAGCAAGTTCATTTTGCAGATATCGCCTTCGGGCTGCTGATTTGTTG
TAACTTCACCTCCTTCTACAAGCTTTTCAGCGGCAGCGTTAGCAATTGGAGCAATTGCTTCCATCCACGACCCACATCGCTGAAGGACGTGAGTGTACTC
TGCCAATAGCTCCGTGATAGACAGCAACTCTGCCAGGGCATCTTCGCTTGTTGCAACCACGTTGGCTGGAGGCACAACAGCGGTAACTGGTGCCTTCGCT
TTTCCCTTCGGGGGAGCTTTCCCGACTGCGGCGGGCGCTGACGGAGTTTCAACGGGGATTTCATTCGCCGGGTCGCGATAAACCCTGCATGCCAACTCCA
GGCGAGATTGGTGTGCTTGCCAAGTCTCCACGATGTTATTCAGCTGAGAGCGATCACTGCTTGCAGCGTTGTGACCACCTACAAGAATTTGGATAGAGGT
CCGGAAGCGATCGCATTCTGCTTGGAGCGCCATTTGATAAATCGCAGCGACCTGTTGGCACATGTCTTCAGTCCACCCGTCACCAACCATACTACTGAGC
TCCTCATCGTTCTCTGCGACTTTAGCCTCGATGAGAGATCTCAGTTCATCCTGCAGGATATCTGCTCGAGcatgcagctcaagctttGTCAGATCGTCGA
AGCGCATCTCATCAACCACCTCGTTGAACTGCCTTTGGAACACATTAACAACTTCTTGCTTTTGGTCGGGACGTCGTACAAACTCACAAAATTCGCTCGT
CATTATCTGCGTACGATCGGCAACACGATGACGCTGCTCCCGTAGCAAGGCAAAACTTGCCTTCATAATAGAAACGTACTCCGTTTCCATGTTATCCCAC
AATGTTGCCAGAGCTTGGGCTGTTGCTGGTACCAGCTCCCCCGAAAACTTGCTGATTGGTACAGGACGGCGCGATCTCTCGTCTCCTATCCAGCTCCTTA
CAGCGGCCATAACGCCGTCAAGCTGACGTTGGgcctcttccagcttctGTCGAAGCTCCACAATCTCCTCTTTCTTTGCCTTTGCttcctccgcctccgc
cacAGATGCCTCACTTTTGGCCACGCCTACCTTGGCCTCGTCAAGTTCCGATTCGAAGGTGTCTAGGCGTCTTTGCCTTTCCTCCTCAGCTGACATGAGT
ATCTGCTCACCCGCCtcttgctggagctgcttggccttcgcctcctcctgGTTTTCTTTCAGAAAATGGTCCACAATGCTTGTAATTGCGTCATGAGTTT
CGCTTACAGTCATGCCCGTGCTGGGTGGCTCGTGCAAAGTTTTGAATTTGGCGTGCCAAGATTTGTGCTCATGAGAAAACCCGCCGCTCGCCAAACAGTG
CAGCGACAGAAGCTCACTTGAATAAGCGGTCGGGTTGACATGCTGCAGACGATGTCGTACGATTGAATCATCCGGAGGTGGATCGAACAATAGATGATGC
TTGTCCCCCGTCGCGCCATCGTCAACTCGACCCAAGCATCGGTCTAAAACCATGCCAATAGGACAGTCGATATGGAAAACGAGATCTATACCGGATTTAC
CGTGGAGTAATGACGGTGACAAGCGCGGCTTGCAGCGACCGGGAGCAATGATCGATTCAAAATCATAGGGAGAAGGAATTAGTGCCGGATCTACATATCC
CGTAAGGTGTTTCTCCAAACTTTGGCCCTGTGTCTCTGTTGCAGGAAGATCGTAGATCACCCAGCCAGCTTTGCTTGCGCTTTCTTGTGCAAGATCTTCT
GCCTCGATCTCCCTGATAGATTCGATCACAAGGCGGCTGTACAACTCCGGGGGGATTTCCTTCCCGTTGACCAGAAAGTTTCCCATTTGATGGCCAATGT
CGCTTGAGTTTTGAACAGCACTTTGAATGAGCTTGTGAACTGAGAGCACGGTCAGATTATGAGTTTCGCCAAGAAGCTTCGCTTGGGTTTCCCTCCCGGC
GAATGGAGGTCCAAAGATAAGAATTCGGAGATGCTGATGAGATCTCATTGAATGTCGACTGGAAGTTGGTAAACTTGGGTCCTCATTGGCCTCTTCAAGC
TGGTTTTCTTTCAACATGGTCCCGGCTTCATCATTTGACGACAGACGAGCGATCCACCGTAGAGACTTAATTTCTTCTCCAAGAACGAAACAGTCCTTAA
TGACCCCCGCCGCCCCAAGGAAAAGAGACCCATCGTTGATCTTTGGCAAGGGAGGTTGCTGATCATTCGTGGTCTGGAATGAGTGAAAGCTCGTCAGGTa
ttgctccagctcgtggctgTCCAATAGCTCAACTTGTCTTGATTCTTCTGGAACAGACGCTGGATACGTATTCTCGAGGTTGTAGCCATTCGCAAATTTA
ATCTTGTACTCGTTCCATGCCTCCGCAGTCAGAAAAACGGTAGGGTCTCTAGAATGCATGGTTTCCTCCCGCTTCCCAGCAATGAAAAGGACGAACTTCA
CCATTTCCTTCATGATAGCGCTTGAAATCTGCTCGCTGAGAAAACGTTCAGCCGCTTCAACGGAAACGTGGACGTTGTTCCGTTGTATATCCTGCATTTC
GCTGTCATCCTCAAATTGAAGGAGAAGATTATGATAGCAGCCAGTATCTCGGTCAATGGCGGCCATGGAGTCCAATTCGTGCTGGTTCACGTACTCTTGG
TTTCGCATTGACCTGTTTTCCCGAGCTACCTCCTTGTACACAAGGATTCGGTCCATTTCGCCTTGTacgtccttctcgctgttcgTGTCTCGTAGCACCA
CATCCTCCAGAATTCTCGTCACACGAGCCGCTCCAACTCGAGAGTGGGTGTAAACGCATTCTTGAACGAATCGCTTCCTCCTTCGAGACAATCTTTCCTT
GCGCTTTTCACGTTGCTTCCGTTGCTGTTTGATGACACCCGATGCGCTCTCCATTTCTAATATGTTTGCATGATAGAGCTCCTTTTCATTCATTGACGAT
CCTGCCAGGTTTGAAGTCGAATATTTCTTCTTGTCGGAAGCTGAATTAAGCGCTGTCGTAAGCGAACGTAGACCATAGCCAACTGACTTGCGTGAAGAGA
CCTTGCTACCTGCAATCGTTCCATTCGATCCACCTTGTGTCTGTAACAAATTCAtttctacatgtagtaagCTCACTGCGCAAAAATTGTCAATAGAGCA
AAGAACACGTCGTCAAAACGCACATCAAAGTTGTCCAGATCACTTCGCACTTTTCGACGCAGGCTGAACGTGAGATTTTCCTGCAGTGATATCATAGTGC
GCAGTCAGCAATTTTTACGCGAGGATAGCATACTCTTTCTGTTGTGCACAAAcctccgcttcttcgcgtttCTTCATCAACTGCTGGAAAAATGCAGCCC
GCCGCTGTTCacgcgcgctcttcttctgcaacgCCAGCCTCCATGCCGGCGAGTCGGTCTCTTCGAGTGCTTCTTTGATGAAGCTACTATGAATGTAGGC
ACGATGCAGCCTCTCCGCCTTCGTCGCCTCCAAGATCTCCCTCTGGTCCGTCATCCTCGCCAGATAGGCCTCTCGCTTCTTAGCTTCCTGCGCGATTCGG
TCTCTGCAATGGCACCAACAACGTTCTCCGCTGTCAAAACCCTTTCCAACTCCCTTCAATTGAACCTATCAGTACTCACTTTTCTTGTTGCAGCGACGTG
GTCGACCGCACATGCCGGCGACTAGAGTGCTCAAACAACAGGTGCGTCTCCAAATCATAGGCCggcttcgccagcttcactGGTCTGTTGTGCAGAGGGA
TGATCCTGGTCcgctccagcgacttggtCGAAACACCCGGAGCTCTGCccactcgagcagcagcgatctgTCGATGCACACACCACAATGAATTAGTATT
CTATGTTGCGTTGTAACGCCAAGTCTCGCAGTGAGCGGAGACCTTGATCTGGTAGAGTAggttggcggcggcgtccttcttctcgttcatgATGGCGGCA
GCCACGTTGGCGTCGAACTTAACGTTGAGGTTGCGCAGCGTGGGCTCCAGCAGACAGAAGTTGAGgatcttggcgtcggcgttgGAGCTGCGCATGAAGT
CGCCGAAGTTGTGCTGGTGGTTGAGGCGGTGCAGGATCTCGCCCAGCAGGTAGCCACTGGCGAGGTCCGCCGCCATGTCTGTCACGTGCGTCGACAGCTC
CAACTCATGGTTGagccagcgcagcagcagctctgccaTCGCAgtagcggcggcggcggacaAGAGTACCGGCTGCAGACGCCTTGATCGGGCGATCCGT
CGGCGCGAAAGGGCGTTGCAGTCTCATTGTGTGGCGCACACGAATATAACATGATTGTGGACGTCAGTTGAACCAGCTGTCGGATGGCGTCGGACGCCAT
CTTCGAACTTTATTGCGAGCAGCGCTCTCGACTCGAGATCACCGGGCTCGCTCACGGGACGATGCTCGTCGCAGAGCGATTGCGGGTGTCGTTGTGTTGG
ACATTGCATGTCGGCGTGGCGTACGAGCAAGCGCATTGCGCGCCTCCTGCGACAACCTCGGGCGCGCAAaccgagccgctgcagcagcaacggctcCTTC
GCTGAACCGGTCTCCCAACTGCAACCAAGCAGCTCCGTATCCGGCGGCGGTGTAAAATGAGCTGCGATGAGGTGACCAAGCGCTCCGACGACCAGCGGCC
GAGTGCCCGCTCACGCGCACCGGTCTGCCATGCAGTGCCTGGGCGGCGCCCTCGTTACCAACGGCGCTTTACAAGCAGCAAATCCTGCGAGTCGAGGCAG
TTTTGCCACGCTGGCATCTCGATTTCAACCCTATCCCCACCGGCTGATCACCTTCACTTTCCGCTCGCCATGGtggcgttggcgctggctAATGTCGGCT
GCGTGGTTGGCGTGCGGCGGGCACCcaacgccaccaccacgagcagtAGCGGCAAAGCCGCGGATAGCGCGGAAACAGCGCCAACGGCATCCCAGCCAGT
GCCGACGAAGATAGCGCCGATTGCTGCTTTCTAGCGATATAATCCGGCGATTTTAGAAGTATCAAAACAGGGTAGTACCGTCAAGTTCTGGCCAAAGCAC
GGTGTGCAGTCGACTTCCGTCGAGACCCTTCGAGACCGTCGCGTCCACCGACATTTGCGAAAGGTACCCTCTGAATTTTTCCCTGCCCAAAGCGATCCTC
ACGTGTCTTGGATACATCGAAGCCGATTGCAGATTGCCGTCGCAGAATCACTTTCACCTCGTGCTGTCCACCACCAGAGAAGAAAGAAGGCAGCCGCAGT
AGCCCTCCCAGCTCTTCTAACATCAACATCTCTTGGTCGTCGCAGACACGCGAGCGCAGACAGGTGCAGGACGACTTGAGCtacccaccaccaccaccac
caacaccGTCCATACCGGATTTTGCTACATGACCCGGAGGCCTCCTTCGCAGTAAGCAGAGTGCCACAGAGAGACAGCAGCCACTCAGAGATCAACCATG
GCGACCGTCGAGAGGTCGAGAGCCCGACTGCCCAAGAAGATGCCGTCGTATGCCGGCAGCGTgtccgaggaggacgaccCGAGCCTCTCCGCCGAGGAtg
aggaggtggacgagacattcctggcgctgcagaagctgctcaaggcgctcaaCCGCACCAACC