Description :
From Genome Similarity Track
Location :
contig_118:40262- 45350
Transcript NameFunction/comments
g11310.t1hypothetical protein PHYSODRAFT_488333

Sequence
5088 bases(100 bases per row)
ATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTCCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCT
GCAGTCGAACAAAGTTGTTCGACGCTCCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTC
ATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGGCGC
CCCGCGCCTGCTGGTCCCTTTAGTTTTTTGATTGCCCGTGACGATACCCAGTATCGCCACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCG
GGCGTAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCGGTCGCACTCGAGAGGTCCATTGGT
TCGGGACCTCCCGACGGCCTTGCCACCGGTCGTGGCATCAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAA
GCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGC
CTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGC
CCTCGATCGGAACTCGTTTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCTTCGTACGTGCTAAAGCACGTAGGATCTGTGAGTCGGCGTC
CGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGAC
CTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCG
AAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGC
CGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTT
GGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGT
GCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTAGGAGGAAGCGTAGGAGTAATTTACTTAAGTTCAGTAT
ACTTGTATCCACAAGTATACTTAAACCTAGATAAATGAACCAAACGAAGCTTTGGTGGTAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAA
AACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGT
CATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTATGCCTTAGTGCATGTTGCACTAAGGTAGGAGGTGAACCGAATGTGTA
GCCCCGCTTACACACCCAATCGATGACCGGATTGCATTGCTCTGACCAGGGCGGTCCAAAATACCATCATACTCGTACGTGATTGGCCAACGAAATAGAA
GGAACACGGGAAATCACCGAATCACAGTCAACTGTATCAATCAGCATTCTGCACGGCTTGTCGGAATGTAGACTGTCTTGAGGGTGTATTAGGTCGTGCT
TGCAGCGTTGAAAGCTCCATAATCGCGATGGACGACGTTTCCATTGCATATGAGATTCTTGTTTTGGTCGGCTTGACAGACACCCCACTTGCGTCCGCCT
ATAGTGCCGCAGCAGATACGCCATGAAGGTGTCGATGACGCGCGCGTTCACGTTGTACGGTGGCGACTCCAGCCCGGACGAAGCGTTGAAGAGTGCTGCC
GCTACGGACTGGATCTTGGACTGGGTATCGGAATCGAAGCAGTCCAGCGTCAGAAGGCGAACTCTTTGTTCGGGGTCACGGCCGCTCAAGACTCGTGCAA
CCCTGTGGTCCTCGGCAGGAGTGTTGAAGACGTACGCGAAGGCTTTGTTCGTCGCCGTCATGTTCCACGCTCCACGGTCGAAAATCCACAGTACGCACAT
TCCAGCTCCATTTGCATGCTGAGCTCCGCCCCGCGAAAGGAATGCGACGTCAGACGCTCGACCACGCCAGCAGTTTTGGCGACTCTGTCCAGAACGCGAT
TGACGTAGCTGTGGATCCCAGGAGCTGCATCGGCTGTCTTGCTCTCATCTGACTTCTTGGCCGTTTGATGCAGCGGGATCACAGCTTCCGGGTGGTCGAT
CAAGTCAATCAGAGGCGTAGCGGGTGTCAGCGTCGCTCGGGAGACTGTCTGCGGCTCCGAAAGTTGGCTCAGAAGCGAAGCCGTCGGAGAAGACTGCGTC
ACCAGTGCAAGCGCGATGGCGAGAAGCGGGCATGTGGAGAAGTCGTCGTCGGGAAAGAGCAGAGGCCTTGTTCTTCTGCAGTCTGACCCGGATGAAGCGC
ACGAAGAAGATGTCGCCTGCGCCAATGGACAGGTTGGCCTTGCGAAGCATCGTAAGATCCGACGCACGCCCAAAGAGGAACCAGAGCAGACACAGCAAGG
CGGCGTCCTGGTAGTCCGCGGAGGTATAAGCCTTCGAATAGAGATATACCATCATCTGCTTAAGCGCGGTCTTCGTGCATGCAGGAGCCTTGTTTACAAA
CGCCCCGACTCTCTCTTCATACAGTACCGTTCTAGTACTTGTCCTTCTTCAGCAGAATCATGTCGATCCCCGCTCGATGCTGAGGGAACTGTTCCAGCAG
CCAGGTCTTGGCCTGTCGGTAGTACTGCATGACCGAGTGTCGGGCTAAGAGCTGGCCCTTGCGCCCTTCCTTGAAGGCGAGGTACATGCCGAACTTGTCT
ACCACAGCCTCCAAGACGAGCGAAGCACTCTCGCGCTGCATGCACACTCCCAAGTACTCCCAGCTGACGAATTCCTCCTCGAGAAACTTCAGGAATGAGC
GTGCTGCGCATTCCCGAGCCCGCTTGGTGTTGGCCGGTGCGAAGTCGTTGAGGCTCATGTTGGGTCGGAGATGTCGGAGCTTGTGTGTTATTCTAAGATA
TACGAATGACTTGCAATCTGTAGAGGATATCAATAACTTCTCTGCTTTCTCCGACACGATACGTCGGAGGTGTGGTTGTGGGCCTTTACGAATTAGCGAG
CTCTCTAATTGGTTAAAATAGATCACACAGACTGACTTGATTGGTTATAAGTTAAACAATTGCCAACCCTTCTTTCTATTGGTCGTTAATATACATAGTG
AAGTTAAGTGCGATCGGAGATTTGACGATATTCATCCATACGAACATCCGGCAATTTTTGATAGTACTTATCTGGGCTAGACTGTACTATAGTGTCTACT
AAACTGTTTAAGATTATCGATACTAACTTCTTTCACATCCCTCCCTCCTTAATCTACGCCAGCCGCCCCCATCCTGGAGTAGCCAGCTGATGTGGTTACG
TCGACACTTAGAAACGTTAAAAAAATATCTTTAAATTTTCTTCTTCAACTTGCCGTTTCGAAATCTACTCGTCATCGCGGTCATTATGAGTATGATATTG
GAAAATGGACCTTTTTAGTTCACAATAAAAAGTCCATTTTTGAAAAAAAAAGTCCATTTGGGGGAAATGATACGTGTTTTGTCAATTTTGTAGTACGTCA
ACAGTTATAGGTTTTGGCCGGAATTGACAGAAGCCGTAGCAATTTGGAAATAGTAAGAGATGTCTGGAGTAGTAGTCACCGTTTTAAAATATCACTTCAT
GATGGTTATGATCTGGATTGCGCCCACTAGCAAATATGATTGTAGGATGCTGTAAGCGCACGGCACACGTGGGTACACAACATGATTTTCGTACTGGATT
TTATTACGTGGAATCCTTCGACCCTCTCATTGGTCAGTAGTGGCTTCTTGAACCTTCGCGATTTATGTGCCCGGGTAGGACACTGGTGTCTGGGGCTGGT
TTGCATTCACCTTGATCTTCTTTGGACTATTGGTCTGAGCTGCTCACTTCTTATCTTTCGAGCCAAGATGAACCCGTCCAACGTCAACGAGAACTCGAGA
GAGTGGTTCTTCAGTGCAGCATGCGCCCGCCAACAAGAGCCGAGATCGACTCCTCCTCGCCCCGGTCTTCAGCCCGACCCGGTGCCGCAGCATTCGCCCG
CTCGACACCCGATTCCGCCAGCCGTTGCTTCCCCGTCGTCGTCTTCGTCGTCATCGTCGTCGCCCTCGATCCTCGACATCTACGTTGGCTCCCACGGCCG
ACGAGCCAATGACCGACGCACCCCCGACTCCCGGACAACCAGCGTACCGCTTGTTCGGCGAAGATGACTTGGACATCGACTACCTCGAGGTGACGGTCCG
TGCGTTGTACTGCCGTACCTGTCTAAGTTGACCTTTGTCTCGGTTCAAGCGTCCGCGAGCACGAGAACATGCTTCTCGTTGCGCAAGGTCCCGGATACGT
GTACGTCGACAAGGCATTCAAGAGCGCTATCCTAGTGCAATTGGGTATGCACTTCGGCTACCCTTTCGAGGGAAGTGATGATGAGCGTGGACTGTTGAAG
TGGCAACGTCGGCGTTTTGAGTGGCTTCGATCTCGCGTTGGTGCTGCTCTCACTGGGTGTGAACTTCTTGACCAATATATATTAACGCCCCAATAAACGT
TTATAGTGGGTCCCCTCAGTATTTTGGGCATTCGGGTCCCCAAAACATTTATCCGGGCCCCTAGGACCCAAATAAGAATATTTTGGGC