Description :
From Genome Similarity Track
Location :
Scaffold_147:40262- 45305
Transcript NameFunction/comments
Aphas_H257_18131dynein heavy chain

Sequence
5043 bases(100 bases per row)
GGCTTAACTTTGACGTAAACCTTGTTGTACGTCATGATATTGACGACCCACGTGCACAGGTTGGCCGCTGCCACGGACTTGGACTTCATTTTCTCGTAGT
TGAAATTCGGATCTTCCAAGATCGGTTCCACGCGCTGGACCACTTCGATAGGGATGTGCTCCTTGTCGTATTGCTCGAGCTGGATCTTGAACGCGTCGAC
CTTGGCCATCATCTTCTTGGCGTTGTCCCACGTGAAGTTTTTCGTTTCTTCTTTGATCATCATGAGCACCGCGGTCGTGACTCTGTCGACCCCCGCCGGC
GGCTTTTGCATCGACTTGAGCTCGGTGAGACTGGCCTTGTTGAGACAGTTCACAGCTTCCTGCGCAGCTTTCAACGCCGGCTGTGCAATTTCCAATTCCG
CGGTCGCCTGGCGCTCGATCTTGGTTGCCGCCTCCGCCGCCATCGCAGCCTTTTGGCGCTCTTCGTCGGCCCTGGCTTGCTTGATCTGCGCATCGTTGCG
CTGTTTTCCCATTTGCTCGAGCAGCGCATCGGTGCCTTTCTTGCGGTCGTCGACTTTCCGCATGGTGAATTTGAGCTCCTTTTGCAGGGCTTCAACATCG
TCGGACGTTTTCTTGAGGGTCCGAAGGCCCACGTCGAGGCGCTTGATCAGCCCTTGCAGCGACTGTCGCTTGTTCTTGAGCAACTTTTTGTAAAACACAA
TCAGCTCCAGGAACGAAGTGGGCGTCACGTAGTTGAACCGGCCTTGGCTTGCCTTGAACTGCACCGACGCGGAGATGACCGACAAGTGCACCTCGGCCAT
GTGGTGGCTCACGTTGTCCGCCAATGCAGCGGATGGCCACTCGATTTCACTCAGGAACGATGCACTCACGCTGACTAGAGCTTCCTTAGGCCACGGATGG
AACCAATCGATCGATACACACTGCACGAGCGCCGGGAATTTCCGAGCACGCAGTCGAAATGCCACCCCCACGGGTGAAAAGGCCAGCACAATGTGGAGGT
TGGCTCGCACACGGTCGAGGAAAAAGTTGACCTAGACAGATCCAGTTAGGGGGGCCATTTGGAAACGACTGTACCATCTGGTCACGCGAGTCGGGGATGC
TGTTGGCCTTGGCTTCGGCTCGAAGCGAGCTAAGAATGGTGTCGCATTCCTCCACAGTGAAGAGATCGGCCACGGACCCATGACTGAGCAGCATACTCAA
GTAAATGAGAAACGTGTCGTCCACAAGCTGCGAGTCCGTGAGCAGGAGAACCAACGGCTGCCCAGGTTTGACAGCAGCTCGGCGGGCCAAGTCCTTGATG
TCTTCTTTGAGCTCGGGAACACCGTAGCTGGCTTTGACGCACAATTGCACCAACGGATACTTGACGATGAACGCTGCCAACTTGGTAAGCGATTGCTTTC
CCGAGCCACCGACGCCAATCAACATGGCATGACTTCGCGGTATGGCCAAGATCCGAACTATCCGCGCCTACGAAAAACGGTGATCATTCCGTAGATTAAA
CCTGACAGGGAAAGATATCGAGTGGGGCGTACCACATGGTCCATGGCTGCATCGAACAAAACCAAGTGCATGACAGGAAACGAGTCGTTGTACGCGCGCA
AACATGCTTGGAGCGCCGTGTGGAGTTCGGCGCGGTCTTTCATGGGAACGGGGGCGGTGGTAGTGACAAAGTCGAGTTCCCGGGGCAAGCGCGTAAACAG
AATCGGCTGCGCGTTGAGCTCGGCCACGTCCTCTTCAATGTGTTTCTTAGCATGTTCGAGCAGCAAGTCTTGGAATCGAGAGCATTCGCTGGCCGACACG
AGACGATCGCAAAACACGCGAGTGCATTCGTGGAGCCAGAAGCGGCCCATTTTCAGCGGCGTCGTAAACACTTCGGGGCGAGTGGACACGAGGCTTTGAA
AGAGCGTGCTGAGGTCGCGCAGGTTGAAGTTGTAGTGGAACTTGAGTGCCGTGGGGAGAAACGATTCGCGCACTTCTGCATGCAAGTCCATCGTGGCCGT
GAGCAGGCCATTCGCCATGCGTTTGACCACGTCGCTGAACGGCTGCAAGTGGTGGTGCCATAACGTTCCAAACAAGTGAACGCAGTCCGATTTGGACGGA
AACAAGTGCCCGAACGTGGCAAAGTGACGCTGTAGCCGGGGATTGATCGTAAACGACCCGGCTTTGTGGTTCATGCATGCCACGAATTGGACATCTTGAA
TCGTTTTTTTGTACCCCACTTCCACTCGGTCGTACCAGCCTCCGTAGTCCATGAACTGCCGCAAGAGCGCCACGGCGGTTTGCGTGCCGTACTGCTCGAC
CATGGGCATGTTGACATCGTCGAGAAAGTACACGAGCGACGACTGGTGCGGCGGGCCATACATGCGGCCGCTTCGCTTCTCGACATGCGCTTCCAGCTGG
CGTTGCAGCGTGGCGGCGTCCGTGTAATAATGCAGCGGGATGCTCGCGACATTGATCGTGTCTTCTTTGTGTTTGAAACAATCGCGCACGACCGTGGTCT
TGCCTGTGCCGCCCCCGCCCACGAGCATCACAGCCCCGCGAGTCGGCAACACTAGCGACAGCAAGTACTGCAGCCGCACGCTTTCGACCGTCGGCACCAC
AACCGAGTAGAATGGAACGTCCCCCAGCGCAATGGCGCATTCCGGCACGACGTCGCTCCACGGCAAAAACTCGTTCGAGTCGATGTGCAAGCGCATGTCA
AACACAGACAACGACGACCCCCCTCCTGGCGTCGAGGTGGCGTCGCCATCCGTCGACGGGGGCTTCATATTGTCTTTTTTCGGCGACGTTCTGGCCAGAA
GAGGCTTGATCAAGTGGCTGAATGCGCGTCGGCTGTCCTTGGGCTCGGCGTCCAACGCGCCGCCAAAGGCCCAGAACGCACAGAACAAAAACACGTTTTC
CAGCACGTCGGGGGACTTTTGAGCGTCGGTGAGCGTGGCCACGAAGCCTTCGAGGAGTCGGCACAGGGTTGTGACCATCGCGAGAGGGGGCATGGGCACC
ATGTACACCAGCTCCTTCTTGTGTTCGGCCAGCACTTGAAGAAACGCGTCGGCATGTTTGCGGAACAAAGCGCTCCACATTCCGCCTTCCTTGCGCGTCT
GCGCCCACGACTCGACGTACGGGAGGTACCCAATGTCCGTGTCGTTGATGTACAAGATGCCGGCGCGACTGACCGTGGCCGGGGTGGCGTTGTGCAGCGA
GTGAATTTCAAACACCATGCGCATGGAATCTGTGAGCGGAATGCGCTCGTTCGAGACCAGCGTGAGCACTTTGTTGTCGTCCATGACAGTGTTCATGCTT
TCGATCCAAATCGCGTCGATATCTCCGTCCAGCACGACCCACTTTCCCCGTTGGTTGGCAGTGTACGGAGTACTTTCCTTGGACATGCTTCGCATGAGCA
TGGACAGAACGCCGTCCTTCCAGTCTCGGCTCAATGTCATGTACCCGTACAACTCGTCGGACGAGACCGCTTTGGGGTTGATCGTTTCGTACACGACCAC
TGGCTTGGGCTGCGACACGTTCAACACGTGCGCCAGCGTGCGCCAAATCGTAGTCTTTCCGCATCCCGCAGGGCCCAGCAGCATGACCGAATGGCGAACT
TTGAGCAGTTGGTCGTAATCGACCATCTTTTTCACAAACGTATCTTCGGTCTGGAGGCCCAGGGCCAGACACACCGAGGTACACTGGGCTTTAAGCGGGG
ACTCTGGCGAAGCTTCGACCACTGCGCTAGGGAACAAGTCTTTGAGTAAGCCGAGAAACACAGGGACGTCTCGAAGCGGCAGCTTGGGCACGTTGAAGTC
ACGCAAGGCGCGCATGAGGATGGTTTCTTCTTGCGCGGTGGGGTCGGCGCGCTTGAGACTACCCGCCACCATGAGCACCGACTTGACGGCGCGCAACCCC
CAGTCGTAATGCACTTGTTTGCTGAGCAGTTCTGAACTGAGCTGATACAGCGTCACAAATTTCTTGGCAAGGGAGCGGGCGTGGAGAAACCCTTCGGACA
TGAGCATGTTCTCGGAGATGGGCTGCACATCGGGACGAATCATGGCACAGGATCGGAACAACGCTTTGAGGTTTTCCGGCAGTTCGGTACGCCCAGCGTA
CCCAGGGTTCATCGTGATGAAGAAGCCCACGGTGGGCACCAATGTGATTTTCTTGCCTTGGAAGTAGAACAGGCCCACTTTCAACGGTGGCGTGCCTAAT
AATACAAAACGACACCCGTGAAATCCATCCAATGCGATTGATTGTATTTACCGGCTGGGACGCCTTGGTATTCGAGTTCCCGGTTGCCGGGAACCGCGAG
CCACGAAATCGCGTCCAGCACCGACTTGACTTGAGTGGCCACCACAGACAGCACTTCGACATTGATGCGGTTAAACTCGTCAAAGCAGCCCCACGCGCCA
GTTTGAGCCAACCCCCGAAAGATATCGGCCATCGTTTGGTAGTTCATTTGATCCGAACAGTTGAACACATAACACATGAGGCCCATGCCCCTTGCCAAGT
CTTTGGTTGTTTCCGTTTTGCCTACATCATGCAATCTTGAGCAATGTACTATATGAAGCACCACAGTTCGCTCGTCACCTGTGCCAGCGGGGCCAGCGGG
GGCGCCCCCCAAGTACAGTCGCAACGCCGTTGTCATGGTGACATAACAGCGATCAGTCAGCGGCGTGATGACGAGTCGTCCGCAGTTGCCAATGTACTCG
TACGAGTATAGCGCTCGGAAATCACAGATGCGAATAGCGACTTGCTTGGTCGTTTGCGGGTCCAAGTAATAGTACCGCAGTTGGGACTGCCACGTAAAAT
CCAGTACCGAGTTGACCTTTTTCGCCACGAGCGTTTGAATGACATCTCGCGCATGCACGTCCACCGTGATGACGGTAATGATCTTCACTCGGTCCAGCTT
GGTGAGCTCGCCTAGAATGGATGGATGGAAACTACTTACTACTAGCAACGCATTTAAAATACCTTGCACCAACTTGATCAAGTCGTCCAACCGGGCGTTG
CACACTTCGTAGTACTTTTTCAGCGCGTCTTCTTGTCCGCCTT