Description :
From Genome Similarity Track
Location :
contig_14:402584- 404185
Transcript NameFunction/comments
g3548.t1XP_009524530.1 ABC transporter-like protein [Phytophthora sojae
g3549.t1hypothetical protein

Sequence
1601 bases(100 bases per row)
GTCTCAACGGGTTCTGGTACTTCCTGTTGAACCTGTTCCTGTCGCTGGTAGTGGCCGAGTCGCTCATGCACGTGATCGGAGCCGCTGTCCCGCACTATAT
CATCGGCATCGCTCTGGGAGCAGGCATCTACGGCATGTTCATGCTGTGCGAGGGCTTCATGGTGCCGAAAGACGTCATCCCGGACTACTGGATCTGGGCC
TACTACATCGCCTTCCACTCGTACTCGTTCAAGTCGTTCGTGTACGAGCACTTCATCCACGTGGACACCCCGGCAGCCAAGGCGATTCTGGCGCGACTGA
ACCTCGAGGACGTCGACACGCCGCAAAACATGATCATCCTGGCGTGCTACGCCATCGGCCTGGAGCTCATCTTCACCTTCATCCTGTACAAGTTCCACAC
TGGGCGTAGGTAATCTAGACGTACTAGACGACGAGAGAAGTGGGTGGAAGTTACTTTGAAGGATATCCTACCAAGCACAATTCAAATGTTTGAGGCAACA
TGCTGTGCGTTTCTGTAGCTGGAAATGTCCGTCAACCCAGTCTGTCGGCCTCAACGCCAACGTCACATCTGCATCAGACCATATTCTTGTTGGTGTTTCG
AGCAGAAATCAACGGCATACTAGGTCCAGCATTCTTATGTGAGAGTCCCAATTCGTCCAAACCTGCTGGCACCCTACAGACCTTATCGAAGCCTTGTCAG
TGTATCCCTCAAACCAACACACATACCAAAATTATCCCCCTAGTTGACAGTTCGATTCATTTCAGCGTCAAATCAATCTAATGGACGAAGACGGAGGTGC
AGTGATGCCGACTGTAGTCAACATTCAAATGGATCTTCCGACTCTGAATCCTTCGACGCAGACTTCTGCCAAAGCAGCGCCAGCTTCGCAGGCAAGCCAA
CTCGGATGACGTCGAACCCGTTCACATTGAGCTGGTCCAATCTCTGCTACACGGTGAACACGAAGAAGAAAACGCCGACGCACCCCGACGGCAAGAAGAC
CATCCTCACCAACGTCACTGGACGATGTGCTCCTGGAGAGCTCACGGCCGTCATGGGACCGTCCGGCTCGGGCAAGACCACACTGCTGGATATCCTCGCT
GACCGAATCGGCTCGGGTACAATTCAAGGGGACATCGCCTTAAACGGAGCGGCCCGCGACATCAAGACGTTCCGAGCAGTCTCGAGCTACGTAGCCCAAG
AAGATTCCCTGTTGGGGTCTTTTACGGTTCTGGAGACGCTGGAGATGGCAGCGAACCTCAGTTTGCCGAGCTCCATCTCTCACCGCGAGGTGGTTGAGCG
CGTGCAGAATGTCATCGACGAGATGGGACTGCGAGTGTGTGAGCACGCCCTAGTCGGGGACATGTTCAGGAAGGGGATCTCGGGCGGCCAGAAGCGGCGA
CTGAGTATCGCCATTGAGCTGCTGTCGGAGCCGTCGATTCTACTACTTGATGAGCCAACGTCGGGCTTGGACTCGGCCTCGACATACAACGTCATGAAGT
TTGTCACGCGGCTCTGCAAGGAGAATATGACCGTGATATGTACCATCCACCAGCCTTCGTCCCTGGTCTACGACATGTTCACGAATGTGGCCATCTTGAC
T