Description :
From Genome Similarity Track
Location :
Scaffold_96:40254- 42965
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_96-snap-gene-0.31Ornithine decarboxylase 1
Pytir_DAOMBR486maker-pir_contig_96-snap-gene-0.21Amino acid transporter

Sequence
2711 bases(100 bases per row)
TCATGAGTGGCACGTTGTGCGCTCTCGCGAACTGCAGGTGCGACTTTTGCTTGATCGTGTTCGCATAGATGATCTGATCCGGCGCGACGCCGTGTGCGAG
CGCGAACTCGATCTCGGGCTTGCTCGCGCAGTCGACGCCGCAGCCGAGTCCCGTGAGCAGCTCGAANNNNNNNNNNNNNNNNNNNNNNNNNGCACGTCCG
GGTTGCACTTCATCGTGTAGAACGGCTGCACGCGCGGGAGCAGGTCCGTGATGAGCGTGTACTTGGCCGCGATCGCGTGCAGGTCGACCGTATAGAATGC
CTCTTCGTCATCACCGATCGCCTGGATGTGCTGCAGCGTGGCGCCGAGCACGCGCGGGTCGAGGACGGTGGCGGAGGAGCTGCTCATTTGAATGCTTTTT
GAGTTGTGAGCCTGGCCATGTGTTTTGCTGGTCAAAGCTTGCTTTGCTGAGTGTATCACAGAATGATGGTCTCTCCCGCCCATCATCGCATCCATCTCCA
TTGACCACACTCGCGTCGCATCAAACCGATGATCACATCGGATTGGATCCACGGGTCAGGAGCTCATTGGGCGAACACGCAAAGTGTTTGGCGAAGTAGG
ATGGTGGGTGAAAATCTCACTTCACGCGCATAGAGTCGTCGTCTTCAACACGAGACGTTGCGATTTGATCGGTGACGCAAAGATCAAAGCCGGAACCGAG
GACCTCTCTCGCCAAGAGAACTGCAGCACGAGAGGTCATCAGCAGCAAGCACGCGAAGCGTCGCGGTCTCTTCGTGAGACGACGGGTACTCGCCACCGCA
CGATTGCTTCGCGTGATACATGAAGCAACCGCTTTGCGATAAAGCGTCGTCAGTGACTGACTATCCATCAATGCACTCCACGCGCTCCTTCACGAGCAGC
TCCAAAGATCCGATCGTGTGCTGGTTGGTGAAGCGGCACCACGAGCAACTGTAGTTCCGCCGCTCACTTACTCGCATTGAAGCTTTCTCTCTCTTTCTCG
CAGGGCGATATTCACCAAGCGACTGAAGCCGCCATGGGGAAGTCTGTGCGCAAGTACCGGAAGAACCGCGACTACGACTACATTGCGCCAGAGAAGGCGT
CTGCATACGACATCCACGACGGCAAAGGCACCGCGCACACTCGGGATGATCATAATGACTTGCTGTCGTCCCCGCGCGAGTTCGTGCCGCTGGAAGAGCT
CGCACCAGGCGATAGCACTGCACTACAAGTCGTGATGTTGTTGGTCGCAGGCTTGGTTGGCTCGACGGTGGTCGTCCTGCCGTTCGTGTTCCTTGAGGGC
GGCTTCCTTATGACGATCTTCATGGTGCTCTTCTTCTCGCTCGCGAGCTACCTCGCCAGCGTGTGCATCGTTCAGTTGGGCGTCGCGAACGGGATCTACT
CACTGCAGGGACTCGCGATGCTTGCGTTTGGCACACGAGGAGCGCATGCAGTCGGCGTCATCCAAATGGTGCTGTCATGCGGTCTCATTCTGACATACTT
GGCGATCATCTTCCAGGATTTCCCCGTGTTATTGGGGCATTTGCTGCACCTGGACTTTGACGCAGACGGGTGGCCGAAAGAGTCAACCACAAAGTACATC
ACGATATCCAAGATCCTCGCGAACCGGACATTATTTGCAGAGCTGTTTGTAAGTTTGCCATTTGTCATCTCCATGACTGTGAACACGGAACGAAACTCAC
TCATACCTCGTTATTTGGCATGCGTACACAGGGATTTATCATCTTAATTCCGTTCTGTCTCTTCGTGCACTCGTATCGGAAGATCCAAAACTTTGCCGTG
GTGTCAACGTTCCTGCTGCTGCTCACGTCGCTATGCGTCGTCGGCAAGGCCAAGTATTTCCACGACGAGAACGTGGCGGTAGCGTCGCAGGGCTTTGAGC
GAGACTACATGAAGGTTCCAAAGACAGTCTGCCAGGCGTTTGGCGTCCTGGCGGCCCAGTTTGCGTGTCAGCACCACACGTTTCACGTGTTTTATGCGAC
GAAGGACCGCTCGATTGATCGCTTCGCACGTTTATCGCTGGTCGCGTGTCTGATGGCGGCGTACCTGGCGTACAGCTTCGGCATCGGAGGCTACGCGTCG
TTTCTCAGCGATTCAAAGACTGACATGGTGGAGAATCAGGATTTCAACTCTAAGCAGGGTACGCTGCCATTCTGGCTGCTCGTGCCAGTGTGCGCGCTGT
TCTGCATCCCACTCGAGGTCGTGTCGTCTCGATATGCTGCGATGTTCATGTGCAGAGCGAGGTCGCAGCACCACCTCGGACAGGAAGAAGTGCTTTTCCG
CGCGCAGCCAGCGACCCGGTCGCAGCAGTACACCAGCACGACACCTCCGGGCTCGCACTCCTCAGCATCGTCATTCGAGAGCAAGATGGCGGATCACCGC
CATGAAGGAGTCGTCAGTACCAGCAGCTATACTCGCGTGCAGATCGTCGTCACATTCCTCGTGCTTGCGATCCTGGTGCAGATCGTAGCTCTCCCAAGTT
CCATCAATATTGCAACTCTGTTGAGCGTCACCGGAGGCATTGCTGGCATCACACTTCTGCTCGTTGTCCCAACCGCTTGCTACCTAAAACTCACTCCTCC
CCACGACGATAGCCACCGTCCAGCAGACAGCTGGCTCTTCACGAAGTGCCTTCCCTGGAGCAGCATCGCCGTTGGCCTCGCTGCGTCCATCGCGTGTGTG
ATCGCAAACAT