Description :
From Genome Similarity Track
Location :
Scaffold_221:40252- 44211
Transcript NameFunction/comments
Phyta_totarag5807hypothetical protein

Sequence
3959 bases(100 bases per row)
CGTGTGCGCTTGATCCACCGGAGGTCTAAGATTTTTTCCACTTCGTATTCACCGGCCTGGTTGTCAGGTTCCCAGCTATCTGCCAGAAGTAACGCCGCGT
CAaagtcgtcatcgtcgtttACATCGATCTGGACTGTCGGACGTTCTGGGAATAACGCACGCGGCTTTAATCGACTGACGTGGACCCAAGGATTAACCCG
ATAGCCGGTGTCATCAATCTTGAGCCTCACTCGGAAGTCGTCGTGCATTTCCGCGATCCTGAATGGGCCATGCCATTGGTGTGATAATTTCCGACTCAAT
CCTGGCTGGACGCGAGGGATGTACAGCCACACTGCGTCTCCGATTTCGTATCCGGCCTTCATGCGTTCTGACAATTCACGCCATTTCTGGGTCTGTTCCT
CCGAAcgcatcttcttggctttcttTTGCAAGTCCTTGGCACACGCAAGTGCGTAGCTGTGGTCCCTCTGAAGCCTCCAACGCCACTCATACGCAGTGCG
TTCTGGAGCGCTCGACGGTTTCGGTCCTAGCATAGTTGATGCTGTCCCTCGGGCGTCCCAACCATGCACCAAGTAGAACGGGGTGTCGAGACGTGTAGCG
TCAAACGACGTATTTAATGCAAACATCAGTCGTTCCGCATGATCGTCCCAGTCACTCTAGTCAGCCTCAGTAATGTAGGTTTTTAAGCTCCGCATGACAG
TCTGCACAGATCGTTCTTGCTGCCCATTCGCCTGTGAACGATAGGCTAGCGTGGCTCGCTGCTTACTACCCAGGAGGTCTCTGAAACGCGTGAACACCTC
GCTCATGAACCGAGGGTCCTGGTCGTGATACAACATGGAACTTGCCCCAAAATGCCGGAACACACGCTCCTCATAGGCTTCAACCACTTCCTGGGCGGTC
GTTGAGCTCATGGGTTTACACATCACATATCCAGAAAATGCGTCCTGGGAGAGCAATATAAACGTGTTGCCGCGCTCTGACTTGGGCATGTGGGTGATAA
AATCCATTGACACAACCTCAAAAGGACGTCTCGGCTCGATATTCCCGGGCGAGGGCCCAGGATTCGGCGGTCGTCCCTTGGCGGTCGCGCAATCCACACA
TTCCTTGACGAATCTTTCCACGTCGGCGTACATCCTAGGTCAGTAGAACTCACGACGCAAGCGTTCATATGTCCTCGTGATACCTTGGTGTCCGCCCTGA
TAGTCCTCGTGTGCATAATGCAACATGTCAGGTCGCAGTGTTTCTGGGACAACTAACCGAGGTTCGGAGACCATATCACGGGGACATTCCTTGGTCGCCC
TGCTTAAGCGATGTAGAATATCGCGAGAGTCAAGGACAAACAGATCAGCGATCTTGGcaatcttcttgagctgagGCCGTGAGAATGCGTCGAAATCTCC
CCTCAGGTACCACTTGATTTGTACCAGGAGTGCATCACTATCTTGGTGTACTTTGATTCGGCGTCATCCCTCAGCCTGATGCTCTAGTGGTCCTCTAGGC
GCATCTTGGTTAGATCTACCTGCGCTTCGGGTCACTGCAATCAGTACTTTAGCGGCATGAGTCAACGGTGCGGATTCTGGTCCTGGAACGACGGCATCTT
GGACTGCTGTATCCTGGGCATCGGCGTTCTGGGCATTCTCATCCTGAGACGGTGTACCCTTCATCAGCTTTTCCTGAATTGTAGACACCATACGCAAGTG
TTCCTtctcatcctcgtcttcgatTCTCCACGACGTGCCAAGGACGAGCGTCTTGGAGGTTATGTAATATGCAGCCTGGTTATACACTCGCTTTACGTGT
ACCAACCTGACCGATTTAACCTTGGCCTTCAATACCTCAAACTCTGCTAGTCGTCATTGCAAGTTGGGCTGGTGACAACCGATGCGTCCCTGCGCTTGTT
GGATGGCAATCCTGGAGTCATCTACTATCACCGACTCCTGGATGTCATGTTCCAGAGCCAGCTTCATTCCATTCACCAGACCGCAGTACTCGGAGTCGTT
GACTGTTACGCCTTCCAGGGAATATCCTCGAGCGTCCACGACGCGCCATCCTGGGAGTTGCCACAGAATGCATCCACAGCTACCCTTGCGGGTGGAAGTC
TTAGCGGTACCATCGAAACTCAGGACGCATCCCTCGTAGTCTGCTTCCAACATTTCCATACTAACCGGAGGTGGAGCCTTGATACGCCCTTTAGCCGGGA
TGAGTGTTTCCGCCACTGCGTCCAAGTGTTCTCGTAGGGTAATTCCTGCGTCCATTATAGCTGCAAGTCCATCCTCATCACGATTCATCTTGTGGATCTC
CAACAGCCACGACATTATGGCCAACGACCACTTGAGACATCGACCGTCCATGGAGCTGGATTTCAGCAGCCAACTCAACACAGAATATCTGGTGTACACC
TTGATCGGAAACGGTGATGTCGAGAGTATCGGTCGGAACTTTTCCAGGACGCGTAACACCGCAATGACTGCCTTTTCCATATGTGGTAGCGCACTTCGGA
TTCGTTCAGGACGCGACCTGTAAACTGCACGGGTTGAACAACACCATCATACTCCTGCCCTAACACAGCGGGTGCTGCCCACGGGTTCGCATGAGGGATG
ATGACGAATGACTTCGTGCGGTCTGGGTGACGTAACAAAGGAGTGAACACGATCTTGCGTTTTAGTAGCTCGAATGCTTCCTTCGCTCTGGTTAAGTCTC
GACCAGAACGCATTTGTTCATCGATCAACTCATACAAGACGGCAGCGATTACTGGGAGAACTTCAAGGAACTTGTTGCAGTAATTCAAGCTGCCTAGGAA
CGACTTCACTCCTTTCAACATGGACGGGAATGACAAATCCTGGACACTTTTGGCGATTTTTGGCATTGCTCGGATTCCTTCAAGTTGATATCATGCGACA
GGTACGGAATAGTCAGCTTACCGAACTCACTCCTAGACAGGCTGACCGAGATGTTCCAATACTGCAGGCAATATAACAACGCATTCAGATCCTCGCACAG
CTGCCCCCAAGTCTTTGCCCCGTGAGCGATATAGTCGATGAACGAGCTTCGCCTCAACGCTGGGCCTAGTTCAGGCGGCATCGGGAGATTACGCTGGAAG
ACCGTCATACTATCCGTTAAAGCAAGTACTTCTGGCACGTCGCGTTCTGGGACTTCGCATCCTGGGACTTCACGTTCTAGCGCTTCCAGTCCTAGATACT
CCAACACATCCTGGTCCACTTGAGCCTCCTCGCCTGGTGGAAGTCTCACGAAGCCCCACAGACAATTATTGATGACACAGTGATAAATCAGCGGTGCATT
CTTTAATCCGAACGGCATTCTGACCCACTGAAAGTGTCCGAAAGGACAGATGAACGCGGAAATGAACGTGGCTCTCTCCGTCATACGAATCGTCCAGAAA
CCACTTGCCATATCCAAACTCATGAACCACATCATGTCCTCGAATTCGATgagcaagtcgtcgatcagCGGTAGTGGATAATGCGACAATCTGATGAACT
CGTTCACCACTCGGTAGTCGATGCACATTCTGAGGTTTATTCCATTCTTCTTCAGGACGATCACAATCGGAGAAGCCCATGGAGACGTGGAGTACTCAAT
GAGGCCAGTTTCCAGCAGTTTCTTTAGCAAGTCATATACTTTCCGCAATAAGTGAGGAGCGACTTGCCTAGAACGCTGTGCTACCGGCCGCGCATCTCCT
ACGTCCAGGTCGCACACGACTCCTCGAGCgggtgcaggagcagcatTACCATTCCCTAGGAAAATGCAGTGGTGTTTCTCCAGGACGCGTCTCATCTGTT
CGTCCATTTCTGGTGTCGTCTTTCCTGGGACACCcacaccagcatcttctaTCCGGAATCGTGGACTCAAGTCTTCCAATTCGGGCAACATAGCAAGTTG
GTCGCGTAATTACGACAACATTTCGCTGCCTTCATGGACGTACACTCCCGGCTCGTCGG