Description :
From Genome Similarity Track
Location :
Scaffold_93:40247- 45878
Transcript NameFunction/comments
Pytul_var.sporangiiferumfgenesh_masked-pug3_contig_93-abinit-gene-0.80Elongation factor P
Pytul_var.sporangiiferummaker-pug3_contig_93-snap-gene-0.30Spastin and Fidgetin
Pytul_var.sporangiiferummaker-pug3_contig_93-fgenesh-gene-0.22U4/U6.U5 tri-snRNP-associated protein

Sequence
5631 bases(100 bases per row)
CCTACAGCTTGTCGACGTACGAGCCGTCCTCCGTCGCGATGCGCACCTGGTTACCCACTTCAATGAACAGCGGCACCTTGACGACGGCGCCGTTCTCCAG
CGTCGCGTCCTTCACGCTCAGCGCCGTGTCCGCGACGCCCTTGGCCGTGGTTTTCTGTATTTGCGCATCAGCAACAAGCAACAGTCAGTCCGCCATGCCT
ACCTAGTTCCCAATATGACTGCGCAGTATCGTACCGTTACAGCGAGCGTCACGTTTTCCGGCATGTTGGCCCAGAGCACGTCGCCTTCGACGATCTGCAA
CGTGAGTGTCATGCCTTCCAAGAGGAAATCGAGCTGGCGTTCTGAAAAGAGATCGCGCGGCACTTCCATCTATGAGAGCATACAAACCCAAAGTGAGCGT
GAGAGAAAACCTGAGCACAAAAAGCACTTCTCCTCAAAAGCGCACAAAAGCAAGCGTACCTGCTCAAACGTCGAGTTGTGCATGAGCACGAGCTTGTTGC
CCTCGTGGTACAGGAACTGGAAGAACTGATCGGGACCGAGTGGCGCCTTCTGCACGCTCTCGGCCGCGCGGAAGCGGCGGTTGATCTTGTTGCCCGTCTT
GATTTCCTTCATCTCAACCTGTTGGTGATCCACGCAACACGGATAAACAAACAATTACCGCTAGTCCGTCAGTATAGATCGATTTGGCAGACCTCCAACG
ATTTCTTTGGTAACGTACCTGCGTGTAGGCACCGCCTTTGCCAGGCTTCACGTGCTGGTGCTTGGTCACACGGTAGATCTTCCCGTCGATATCCAGCGCC
ATGCCAGGACGGATCTGGTTGCCTTCACGTGATACAAGCAAGATATGGCACACGCACGTCTGTCAGCGACTAGTACTGTTCGTAATGAGCGCATTTGCGG
CAGCTACAGAACAGCAANNNNNNNNNNNNNNNNNNNNNNNNNCTGCTGCTGCTACTGCATGCAACGGCACCTAAAGCGCACCATTGATGCTCGCAAAGCG
CACGCCGAAAGGCTGGATGTTGCCTGCGCCGGCGCGCGCAACCTGGCCCACAACTCGTCGCAACATCTTTTTCAATTTCGTCCGTTGCTAATGGAAAGGT
GGCGCTGTTATGAAAGGCGGAAACGCAATGTGGCAAATCTGCGTCTCTATTCGTCGAAAACAAGTAAAAGCAAGATATGATTGGATGAAATTTTTGAGGA
GCTACACTCTGGGTGCACTGATAATGCTATTGGCGCCAAGAAGAAAGAACCGACGACGACAGGAGAGAATGAAGCGCTTNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCTCACGCCGAACAAGTCCGATGACGCGGAGATCAAGCAAGTGCTCGACGAGGCCGTCAAGGCTGACAACAGCGGCGACTTCGCGCGC
GCAGTCGATCTCTACGCCGACGCCATCGAGAAAATGATGCAGAGGCTGCAACGTACGTGTCCACGATGCTGTTCTTGTTGGTGCATATCTGTCGCGTTTG
ATTGTAATAAGGCCTTGTTTGTATGCATGTACCTGCATACAGAGCTAACGCATGCGGACGAGAAGAAGAAGTTCTTTCTGCGGGAGACGATTCATCATTA
CATGACGCGCGCCGAGAGCTTGAAGGAGCAATTGCTTCAGCGAGAGCACACGCTCCACGGCAGAACAACAGCACACACCAACGAGGTTTGCTCTTAATAT
GACAAGCCTTCGTCTTCTATTTGCACTACGCTGTTGCGCATAATTGACTTTCTTTCTTGTGAATGATCCCAGGCTGCATCGGAAATGACAGCATCACCAC
CTACGACGGTATACGTTGCGTGCTGCTGATGGATACATACTGGAATGTGCTCTAAAACGAAAACTTGTGTGTTGTTGCGCATAGGCTGCTGCTGCTTCCT
CGGGCCATGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCTTCCTCCAGCACCACACGCAGCACGCGCACACGATC
CTCGACGAAGTGCTCGACCGCTCGCCCAAAGTGCATTGGGACGACATCGCGGGGCTGCACGTCGCTAAGCAGATCCTCCAGGTTGGTGAATTTTTGTTAT
ATTTAGACGCACTGTGTGGACGGCGCGTCCGCTCGAGATTGAAGCCACCAATTTGATGGTTTGATTCGATTTGCACGCGTAGGAAGCCGTGATTTACCCA
AGTCTGCGACCGGACTTGTTTACGGGGCTATTGGCACCACCCCGCGGCGTGCTGCTATTTGGACCGCCTGGAACTGGTATGTCGAGCCTCATTGTGCACT
GAATAGGCTAGAGGACGATTATGTGCTTAGTCTATTGTGCTGTATTTGCAGGGAAGACACTGCTTGCAAAAGCCGTTGCGACCGAGTCAAATGCTACGTT
CTTCAAGTATGTTCAAGCCTGTGTCCACAGACAAAACACAAAAGTGTCTCGTTCTCATCATCAATGTGTTTTTTTTCCTTGTGTGCATCTTTAACTAACT
ACTTTAGCATCTCTGCGTCCACGCTGACGTCCAAATGGGTCGGTGAAGGCGAGAAACTGGTGCGGACGCTTTTTGCGATCGCGCGCGAGTTGCAACCGGC
AGTGATCTTTCTGGATGAAATGGATGCACTGCTGTCGACGCGGTCGGCCTCCGAGAATGATGCTAGCAGGAGAATCAAAAACCAGGTAAGAGACGTACCT
AGAACTGAATGCTATTAGCCTGCACGAAGGACTTGGATTGATGGATTGCGTTGCATGATGTAGTTCTTTACCGAACTGGATGGCGCAGCGTCGTCACCTG
AGGACCGGATTCTCGTAATGGGTGCGACCAACTTGCCGCAAGAACTGGACGAAGCGATCATCCGACGCCTTGAAAAGCGGATATATGGTACGAGCCACCT
CTAGTGTTGGGAGGTAGAAAGCCTAATCACATTGTTGCTTGTGTATGCCATAATGCAGTCCCTCTCCCTGATGAGACGTCGAGAGAGACACTAATTCGCC
ACTTGATCGGGTCGCAAAAGTACGCGATCTCGTCCCGTGAGATGGCGAGTCTCGTAAAAGCCACGGATGGATATTCAGGGAGCGACCTCAAAGCACTTTG
CAAGGACGCAGCCATGGGGCCGATTCGCGAGCTTGGTGCGCGTATTCGAGACGTGAAAAGCGAGGACGTGAGAGGCGTCCATGCAAGTGACTTCAAAGTC
GCCATCTCGCGGGTGCGTCCGAGCGTTTCGAAAGAGACGATCAACTCGCTGCTCGCTTGGAATGAGCTGTACGGCGTCTCTGCAGTAGCCAAATGAAACA
CATCGAAAATGTATAACAGCTGGGAATAGTTTGGATCGCGATATGCTCCTCTTTTTCAAGGAGCAGCTTGCATGCTTCTTGCTATTATCCCATGGTTGGA
TTGGTTGATATTTGCGACTCGCTCACTGATTTCATGCTTTCCGTTCGTAAATCATCATGTACGATTCGGACACGCCAATCAGTTGCGGCATCGTCTCTTG
AACGTGAAGGTCCTGGATTTCATACCATTGTTCAGTGGCCTGCATACGAAAAACAATAGCAACAAGGGTGAGATAGGCACAATACCGAAGCTAATCTAAC
TGACGCGACTTACTCGATTTTGCACGTGCACACGGTAGCTTCCTTCTGTCAGCGGATTGGTTTTCAGAGATGCCTCTTTCCCGGTCGTCACGGGGCTATC
ATGCACAATGTTGGCAATGAGGTTGTACTTTGTCGACGGCACTGTGACGCGCAAGACCTTCTCAACCAAATCTGCTTTTTCAACGCAATCCTATAGCAAC
AAAAACATACCCAATTCGTCAACTCTCGTAATAAAACGGACAGATTTTGAACACAATAAGTCTCAAAACAAACCTTCGAGGGCACGCTGTGCTTGGTCAA
GATAGCACGCAAGTCCGCGATCGACCTAGTAGGGAAACAAATGTAGAGGCATCAGTCATTATTTGGATGCTCCATAGAAATTATTGTGATACTCTAAGAC
ATCAACTAATAGCGACTCACATGGCACTCAATTCTTCTTCCGTTGGAATCGATCCATCCAGATTCAAGTACTCGCGTAACTCGAGGTTCTTGATCGGAAA
GTTGACAATAGTCGGGTTCTTTTCAATGAAAAAGTTGTTGCGGGTGAAGCGCTTGACGTGGAAAATGATGTACGGTGGGAGGGATTCGATCTTGTACGTC
TTCTTTAAACGTTGCGAGCCTTGGAGCACATGCTGCCGAAATGATATCAAACAGCCACGCACAAAACGTTAGAAAAACGATAGAAATTTGCGACTGAAAG
GGTTGTCTTGCACTCACCGTCACGTGAGTTCCGTCGTACTTTTCAAGCACGGTAAACAATGGGACCTATGTAACAGAAACCATTTGAACCTTTAGCTTCA
CGGCTATCTCAAAAGCACACACACTGTTCAAGATACCGCATACCTGAGGAATGATGTTGCCACCCTGAGAGTCCTTGAAGAGAGGGGTCGATGGCAAATC
CAATGACATCAACCTACACAAGGCAAACAATCCGCAACATTAGCATCATCATCTATGCTCATTGCTTCCAATACAGATACGAGCTTGTAGGCTTACAGGA
AAGGAGACTTGGCAGTCGTCGTGGCGAGCGCGCGTTTGCTCTCATCGCTCGGGTCTACGACGGCTGCCTTGCTTTCGTCGACAGTCGTCACTTGGACGAA
CCCTTGAAAGCACTTGTGGATGACACTGCTCCCAGATTTCGAAGAGCCGCCGAGTCCACGATGCAACTCATTCAGAAGCCACGACAAGAACTCGACGCTC
TCGTTCTGCTTGCCAACGTGGAAGCGCTTCTTGCTGCTCACCGACACCTCCTGCACAAACTCATGTGGACTGATCTGGTTGTCCACAGTGATTACCATCA
TGTTAGAGATAGAGGCGATCATTTTGCTGTAAAAAAGAACTCAAGCCATCATACCGTGTTCTTGAAATTGTGCGGACTCCACATCTTGCGCAGCAGTTCG
CCAAAGCGCTGCACAAGTTGGGACTTGGACTTCGTCACGACATCCGAGGATTGCAAAAAGAAATCACGCAACGGCGGGATATGCGCCAATGCCTGGACGA
TCACGTTGATGTAGTCGGTGTTTTTCAGATTGTTCAACCCAATAAACCCTACAAACGTGCAAAAACGCGTTAGATACACACAGAACACAGCCATTCTCAC
ACACGCTGTCAATGCATCAATAATACCTGGCAGGTACGAGACACCGAACGCATCCTGTGCCAGGATGCGGTTCTGGTCGAGCTTGGTGATCTGACTCGGT
TCAAAGGACGGACGCAGCGCGAGCTTGATCGGCTGCAGACTGTGGTCGACGACCTCGTAGTTGTCCGGCAGGCAGTAGATCTTGTCGTTCTGCAGGTTGA
TAAACACGTGGTGTGCGCTCTGCACCGAGTGCGTGAACGCGTGCGTGGCCTTGCCGCGGCCCTTGAAGTACTTGCCGCACACGAGGCACGCGTACACGTT
CTGGTCCGAGAGCGAGATGGAGCACACTTTTTCAAAGTCGAAGTCCAGCATCTGGTGATTGATCGTGTCCAGGTACGGGCATTTGCGGCGCTTGTTGTTG
TTGTTGCTGTCCGTGCCACCATGGTCGTTGC