Description :
From Genome Similarity Track
Location :
scaffold_196:40237- 43962
Transcript NameFunction/comments
g5476.t1 ATP-binding Cassette (ABC) Superfamily

Sequence
3725 bases(100 bases per row)
GCCGTTCGAGGAGTGAGTTTAGCCATGTACAAGGACCAGATCACGTGTTTACTGGGACACAACGGAGCTGGTAAAACCACGCTCATCTCGATGCTCACGG
GTATGATCGCTCCGTCTTCAGGTGACGCCTCTTTCCGTGGGCTTTCACTGGTGCATGACATGGGCGACATCCGGCAGTCCTTGGGGCTCTGCTTCCAGCA
CGACGTGCTGTACAGTGAGCTCACCGTCGAGGAACACTTGCTCTTCTACGGACGTGTAAAGGGCTACCGCGGTGCTGCGCTTCGGGAGGAAGTGAACATT
AAGATCACGGAAGTTGGACTTACTGAGAAACGCCGTGTATTCGCTGGGTCTCTCTCAGGTGGAATGAAGCGGAAGCTGTCGGTAGCGATCTGCCTGCTTG
GTGACAGCTCGCTGGTGTTCCTGGACGAGCCCACGAGTGGAATGGACCCGTACAGTCGACGCAGCACGTGGGAGATCCTGCTGAACAATCGAGCCAACCG
CGTCATGGTGCTCACAACCCACTTCATGGACGAAGCCGATATCCTCGGCGACCGCATCGCCATCATGGCTGAGGGTCAACTGCGTTGCTGCGGTTCGTCG
CTCTTCTTGAAGAATCGCTACGGTGCTGGCTACAACTTCACGCTGGTCAAGAGCAGTGATCCTGCTGCTCCTTGCAAAGACGCTCAGCTCCAGTCTCTCA
TTACGTCTCGCGTACCTGCTGCCAAGGTCTTGAGCAACGTCGGCGCTGAGATCGCCTTCCAGCTGCCATTGGACAGCACCGCCTCGTTTCCGCAGCTTTT
TGAGGAACTGGACGAGAAAATGAGGGAACTTGGCGTGCTTTCGTACGGCATCAGCGTCACTACGCTTGAAGAAGTCTTTATCAAAGTGGCGGAGGCGAAT
GACGAAGACAACCAGCACACACTGAACAAAGGTGCTAGCCCTGACTCTGCTTTGCCTCCCGGTGGTCCGTCCATTGCCAACTTGACTGGTTTCACCATGT
TCCTCGTTCACCTGTCGGCTCTGCTGCTCAAACGCTTCCGGATCGCGAAACGTGATCGTCGAGTTATCATCTTCAGTGCGCTTCTACCGGTGACGCTGCT
TGCCGCAGGTTTCATTATCCTCAAGACGAGTGCGCTCACCCGGTCGGACGTCAAGGTGGCACTCAGCACTGATGACTTCGAGGCGAAAACGCCCAGTGTA
CCGTACTTCTGCGAAGCGGACGACTCGAAATGGTGCTCAAAGACGATGGACTCACTGTTCACCGGTGGCAAGTCGTCCCCGTTCACGAATGTTGAGATCT
CGTCTCCCCCGTACGCAGTTTACCCCACGTCAGTGTTCGGAGTGAACTACAGCGAAGCAGATCTCGAGAGCTCCAGTAATCCACACAGCAACGAGTTCTG
TCTGCGCATGGGCGACAAAATCTACCAGCGAGCCTTTGGAAAGACCGACCAAGACATGACAAAAGTCACGCAAACCCCAGTCACCGGGCAGTACGGCGGC
TATCTCGTCCATGCCTCTGGAAGCGAGCAACTGTTTGGTTATCACCTGTTCGTCAACACCACCGCTGCGCACGGGGCTGTGATCTTCAAGGCGTTGATTG
ACCAAGCTCTGTATCGTTTCATGGCCGGTGGCTCGACTGACGTGACGCTGAAGGTGAACACGTACCCGTTGCCCATGACAGCAGCCACACAGGCGCTGTT
CGGGTCCTTCTTGGCCTTCACTGCGTGCATCTTTATCGTTATCGCCTTCGCCTTCTTCCCAGCGTCCATCGTGGGGTTCCTGGTCAAGGAGAAGCAGGCG
GAACACAACTCCAAGCACCAGCAGCTCGTGTCGGGCGTGAGTCTGCCCGCGTTCTGGCTCGCGAACTACCTCTGGGACCTGCTCACGTACGTCGTGCCCT
TCATCGCGGCCATTGTGCTCATCCAGATCTTCGACATCGCGGCTTTCACGGGCAACGACTGTGTGAGCTGCACGGGCGAGACGTTCTCCGCCATTGTGCT
GCTCTTCATCCTGTTCGGCTTCGCGATCTGCCCGTTCACGTACTGCCTCTCGTACTTCTTCAAGGAACACGCGTCCGCACAGACGTACACGATCATGGCC
AATTTCCTTCTGGGCGTCGTGCTCATGGTGGTTTCCTTCATCCTGGACGTCATCAGCACGAGCAGTAAGGACGCCAACAAAGTGCTCAAGTTCTTCTGGC
GACTCAGTCCGCTGTTCAATCTCGGTAGTGCGCTGCTAAACCAGTGCCTAAGTGAGATCGGAGCTGCCATGGGGCTGTCATCGAAAACCATTAGCCCCTT
CAAAATGGATGTCATGGGCTGGGAGCTGCTGTACTTGGCTCTGGACGCCATCTTCTTCTTCACCGTTGCAGTTGGTATCGACTTTTTGCTGAGCTTCCCC
AAGATCAAAGCAGCCATCTTCAAAGACCCCGTTCTGAATGATGCCCCGTACGAAGAAGATGAAGACGTGGCTCGAGAAGCGGAACGTGTGCGCAGCGGCG
GTGCAGACAATGACGCGGTGAAGCTCCTAGGCATCCGCAAGATCTACAAGGGCAACAAGGTGGCGGTCCGCAACTTGTCGTTCGGTCTCCCCAAGGGCGA
GTGCTTCGGCTACTTGGGCATCAATGGCGCTGGCAAGACCACAACCATGAAGATGATGACAGGAGACATCCTGCCGACGTCAGGCAGCGGAAAACTCGGG
GGCTTTGACATCCTCAGTGAACAACTGGAGGTGCGTCGCTTGATCGGCTACTGCCCGCAGTTCGACGCTCTGTTCGAGCTCATGTCGGTCCGAGAGCATC
TGGAGCTCTTCGCCCGTATCAAAGGCATATCGCGCGCAGACTTGAACAACGTGGTCAAGTCGCTCATGCACCAGATGAACCTGGACGACTTCGAGAACAA
GCTGGCGGGCACTCTCAGTGGCGGTAACAAGCGGAAACTGTCCGTCGCCATCGCCCTCATCGGGTCGCCGCCCATTATCTTCCTAGACGAACCCTCGACC
GGCATGGACCCGGTCTCTCGTCGCTTCATGTGGAACGTCATCGCTGCCATCTCCACGCAGCGGAAGGAATCGACCATCATCCTCACGACGCACAGCATGG
AGGAATGTGAGGCGCTCTGCACGCGTGTTGGGATCATGGTGGGCGGTCGACTTCGGTGTCTGGGCAGTGTTCAGCACCTGAAGAACCGCTTTGGAGACGG
CCTCATGCTGGAGCTTAAACTGATGGGCACGCCCACACACGACATCGACGTGCGCGTGGCTTCAGTGTTCGGTGGAAGTGCCTCGACGACGACGTTCCCT
CGCGCAGAGTTGCAGGCCAAATGCGAGGCGCTGGGCAACGCGTCTTGGGCCGACAAAATCGTGATGAACCACGCCACGGGATACGCGTTGGCCGCGGCGA
TCGAGCGAGACGGCACCATGAGACTCGGGATGCTTTGTGCGTGGTGGGCGGCGGAGGAGCGCTTCTTGGCTCTGGATGAGTTCCTGCGCGAGAGCTTCGC
AGCCGACGGCAACACTGGAGTGAAGCTACTTGAGCGGCAAAACGACCTCTGTCGCTACAAGCTCACAGGTCAGGTGCCGCGACTAGCGAGCGTCTTCAGA
CGAGTTGAAGGCAGCAAGCAGCAGCTCGGGATCCGCGAATATGCCGTCTCTCAGACCACGCTTGAGCAGATCTTCAATAACTTCGCAGGCCAGCAGAGCG
AAGAGAAGGGCGTGGCGCGCGGCAT