Description :
From Genome Similarity Track
Location :
contig_24:402368- 403918
Transcript NameFunction/comments
g5717.t1XP_009529659.1 hypothetical protein PHYSODRAFT_263115 [Phytophthora sojae

Sequence
1550 bases(100 bases per row)
TCAAGATCTCGATAGCTGCCAGAATGCTCAAATCCAACTTGCTATTTGCAGTACCGGACGCAAAAGCAACGATGCAGTGAAAACTCGACTGAATTGGTTG
TTTCTTCGATGCAAGTTTCCTATCCCCAAGAACTGCGAATTCAAATAGAGTTAATCGCACGAGAAATACTGAATGCCAGTGCATGTCGGACCAGTTGTCG
CTTGCGTAGCTGGTCAGGCTCCGGCATGTACCTGCGTGGAAACTGAAGGACACGCAGAATCCCCTCCATGTCACTCTGCAAAAGTTGCTCCTTCAGTTCA
TCGAGGATTACAAGCGAAACGCTGAACATGATTCGCCACCCATCAATAACAAAGATATCCAGCAGGCGGGTCACCAGCGTCGGTGCTAACGTCTCGAACG
ATGAAAAGAACGTCAAGAACCATCTTGTGCAGAAGGTAGCAACATGCACACCCTCAGCTTGGAGATGTGTGTATAGCTCTGGCATGTGCGTCGAAAACAA
AAGCTCGAACTTCGACAGATACGGCTGCAGCACGGCCATTCCCGGCTCATAGAGATTGCGGTCATTCTCCGGCTCAGAGAACCCCACGAACAGCCAGAAA
ATATCTGCTTCATCGTTAGCGACTTCAGCCAGCAAGCGCACTAAAAAGCCCATCCCTTGGCAATAGCCCACACGAGGGTTATAAAGGACGTATGCACGGA
GCACGCGACGAATCTTCGCTTCCAGTTCTGAGTTTTCCGTGCTGTCGAAACTCGATTCACTGCCTTCATTTCTGACAATGCAGTCAATCAACTCCATCAT
GACGGACTCAACCGAGTCTTTATCATTGCTCATCTCAGTACTTGATATTGGTGGAGATAGACTCGAAACCGTTTCCACATTGCCGTCATGTATGCTTCGG
TGGCAAGTTCGCACGACATCAACGTCAATTTCCCGGAACCAAACTGCAAGCTGGGAATCGTCATCACTCAGAGGCAACCCTTCTGCAATTAGCCCGTCCG
CTAACTTTACCTCCACTTTCGTCAGAAGCTGATCATACATGCTGTGGCGCCTGTCTGGAGAAAGGTAGTGGGATGCAATTCCACTTGAGCGCCATGGCGT
TGACTCATAGAACACTGAGAGCCAAAGTGAGCTGCGAATGGCTGGAGATAGTCCGCCCGACCGGATGCACTTTTTCCAAATAGGGGCGCTATCAGTAGAT
GGGAACGCAGCCGAAAGTTGACCTGAATGTGTTGGGATCGCCATGATCAGTTTAAAGAAAGAAGCGGAAAGCAAATAGATACTCACCTTGGACAGTCGCG
CAAGGTCTTCGACACGAAGGTACGACAGGCATTCGAAGTACAGCGCATCGTGCTACAAAGCCACAAGCATGTTGTGAGAGGATTACACATTATACACAAG
CTAGCAGGCCTATGCTAATCAAACCTTTTGAAGTAATCCAGAAAGAAGAACATCTGCGGTGGAGCTGATTGAATCTGCCGTCAGTAGCGATTTCCCGGGT
GATTTAGCCTCCCTCAAATCAATTTCCCACAAACATTCTTCGATGGCTAG