Description :
From Genome Similarity Track
Location :
Scaffold_41:40223- 41233
Transcript NameFunction/comments
g12590.t1XP_009523436.1 hypothetical protein PHYSODRAFT_496021 [Phytophthora sojae

Sequence
1010 bases(100 bases per row)
TGCACGCGCAGCTCACGCGCTTCTCGGCGCTGCCCGATGCCGAGATAGTCGAACTGCTGCGCGTGCTGTCCGAGTTCCTCATCTACTCCGACCAGCACCG
CGTGTCCGTGGATCTGGGGGACCAAGCGGAGGCGGACGACGCCGGCTCCTTCTTCGACTACTTCGGAGAGACTAACATGCTCGCGCTGCTGGTGGAGCTG
GGCGCCAGCCAGCCCAGCGTGCCGGTGCAAGTGCAGCTGCTGCAGACCATGAGTATATTGGTGCAAAATATCGCAACGCGCACGTCGCTGTACTACATTC
TGAGCAACAATCACGTGAACCGCCTGCTGGAGTGTCCTTTTGTAGTGGACAGCGATGACGACGTGCGGGACTGGTACGTCACGTTGCTAAAGGCCCTGTC
GCTCCGGTTGAACGAGGAGACAGTGCAGTTCTTTTTGGACACGCAGCACGGAGACGACTTCAGCTTCCCGCTGTATGCGCGCGCACTGCGGTTCGGCAGA
TGCAACGAGACCATGGTCAAGGTCGCGGTCAAGACGCTGACGCTAAATGTGCTGAAAGTACCGGACACGAGAGTGCGGCGGTTCGTACTGCAGTACGACG
ACCTCAACTGCTTTCGGGATATTGTCGAGATCGCGAACGACTTGACGTTGAACTTGCAGGGGCTGCTGAACAATTGGCCGACGTCGGAGGACAAGGTGGA
ACGGACGGCGGGGACGGAGAAGCTTGAGGAAGCAGTGGACGCGTACATTGACCACTGCTTCTACCTACAGGATCTGCTGGATGTGAATGTGCCGGAGCTC
TGCTATAAAATTGGGGACTTGCTCTTTTCACGGCATATCAAGAGTTTGCTGGCTACTAGCATACTACCGGATTGCGGACCGCCGCCACAACGAGTTTCGA
CACAGTTGGCACTTTATTTACTCACAAGACTGTTGGGCATCTTGGAGCATGCACCTCTCGTAAATGCAATAGCCTTCATGTTGTTGTCGCCTGATGCAAC
CGAAGACTGC