Description :
From Genome Similarity Track
Location :
Scaffold_1685:4022- 5589
Transcript NameFunction/comments
Phypl_g13958reverse transcriptase

Sequence
1567 bases(100 bases per row)
CCCACATCGGCTCGTCGTATCCGGCCCACTTCACGTTGAACTCTCGGACAGCCCGGCTGGTGTCGGTTGACAACGGAGTTCGGTCATCGAGAACGACCTC
AACCTCAAATTCGCCAGATAGCTAACCAGGCTCCCAGCTGTCTTCGGGAAGCAACTTCTCGTCGAAGCCTACTCGCGTAGCCTCGGTCACCCCTGGTACC
AGTCGACGTTTCGGTCGGTCTGCATATTCGTTCACGGCCTTGAGTCGAGAAACATCCACCATCGGGTAAAACCTATATCCACTCCGATCGGGCAATTCCA
ACTCGTACGCAAAATCCTAaaccttcttcttcacacGGAATGGCCTGTGCCATCGGTGGTCCAGTTTTTTCGTCAGCCACGATTTCACGCGTTTCATATA
CAGCCAGACTCTGTCCCCTGGGTGGAAAAGAGAGCTCGGTCTCGCGTCAGGAGCATCGTCTGCTGCCCCTGCCTCTAGTGGATCCTCGCCCGGCGTCTCG
TTCTCATCATCAGTTGTCGGTACGGCCGCTTGTTCACGTCTCCCAACCAGCTCATTGGGTTCCTTCGCTATCCGAGCTTTCTCAGTGGCCTGATGTTCCG
TAGCTATTCACCACGAAATCTCCTGCTGTCGGTTCATCCCCCGGCGCCACGCATGGGCGGTGGTCTGGTTCCCAGAACCCCGCtggagcgacggcgacat
TGCTCGGAGCGTGGACTGTGCATTCCAACCATGAACGAGTCAAACCGGAGTGTCTTTCTTCGTTCCATCTTGTGAGTTGTTGATAACGAAAATCAGTCGC
TCGGCAATCTCGTCCCAGTCTTGTTGCAGAGGATATTCGGCATAGACACGTACAGACTGCATGACTGTCTTCACCGACCGTTCCTGCTGACCATTCGCTT
GTGGCCGATAGctccgcgtcgctctcgacTGAGATTGGATCATCTCGGCGAAGCCTTGAAAAATTTCGCTCATGAACCGTGGGTCACGGTCGTGACGGAT
CAGCGTTGACGCTCCGAGTCGTCGGTAGACACACGCTTCGAACGCTTGTGCCACAGTCGTGTCGAACATTGCTTTGCCCATCGCAAAACCGGTAAACGCG
CACTGGAACAGCAGTAATGCCGTGTTCTCACTGCGAGACTTCGGTAGTGGTATAATGAAATCCAAAGAGAAAATCTAGAACGGTTTCTCAGCCAGGATGT
TCTCCGGTGAATAGCCTCGGAACTGCGGTCGGCTCTTGCTCGAACTGCAGTCTGGGCAAGACTTCAATTGTCGCTCCACGTCTGCATAGAGGCCTATCCA
ATAGTAGTCCGTCCTGACTCTGCAATAAGTCCGGCCGATACCTTGGTGACCGCCTTCCAGCGAGTCGTGACAGCTCTGTAGTACCACCTGAATCATCGTT
GTAGGTACCACTAGACGCATCATCgtctcttcttgctgtttGGTGCCCCACCGACGGTTCACTCCAAGAAAATATAGTACATCGTCTTCGCTGAGCACGA
ACTTGTCCGACATCTTCCATGCATCTCTCGTCGCCTTGTAGCCGAGcttcgcttcttcgcctcgtAG