Description :
From Genome Similarity Track
Location :
Scaffold_919:4022- 5102
Transcript NameFunction/comments
Phypl_g11641hypothetical protein PHYSODRAFT_510403

Sequence
1080 bases(100 bases per row)
AAACCGTTCCTTGGGGGATTTAAACATCGTAAAACGCAACAGCATTTTCACCACGCCTCCACTCAGGTACGGAACTCGCAGAGTTAGCTCGCTGCCAAGT
GTGTGTGCGGCTAAGTGAAGACTTGTGTCTGTGGTGCAGACTATTTTATCGCGAGCACGCCGCAACATGGGCCCCGTACGATTCCACCGCGAGACACAAA
CGCAAGAGCTCGCGACTCGATCCTTGCAGACACATCGCGAGTCGGGCACGCAAATGTCTCGAGGCGACCTTAAGCTGGACGAGGCATTCGACCGTCACGT
AAGCGCACGACCGTACTTCGACTCGTACCAGCTCGACAGTCTCCGAGAAGACTCGgtgcttctcctgcagcgactgtGGCGCGGGTTCCGAGCGAGACAA
TACGTGTTCAATATCCTagagcagcggcgtcgagtGAGCATGCTCGCAGAGATCGAGGCCCAGGAGAATGCAGCCGAGGACGTCAGTCGCCAGCGTTGTG
AAGTCAATCGCCGCATGCACCCGAACACTGTAAAcgacttcgaggtgctgtACAATGAGCTGGACAAGTGGCGACAAGTTGAGTGCCGAAAGGTTCGTGA
ACAACGAGAGCTGGATCCGTCTGAGAGACAGCGTGCGCTTGATGCGATCCTAGCCAAGgagacgaagctgcttcagACCATAGACCGTCTTAAGTTAACG
GCCACGGACGCAAACCGCAAGCAGCGCATCAAGGCCATGATGCAGTTTATGGCACGTCCAAAGCAGTGGCAAATGAGTGACGGCAGCATCAAGGAGGTGC
ACACACCGTTCACGGTGCGTGCCAAAGAACTCATGGATCTGTACCATGGCTTGCGAGCGTCACTTAGTTCAATGGACGAACGCTTGGACATGCTGCTTCA
TATCAAGTGGACCGTCCAAGAGTTTGATTGCGCTCTCAcgcgcgagctcgtggaactCATCGACCGAGAAGCCGACATGCTGAGCCGCGGACGGAAAGAG
AAGAGCCTCGAGGGGCTACGCAAACGCCTCACCAACCTCTTTCTGCAGTTTATTGAGACACCGGAATTCAATCCGGAGGC