Description :
From Genome Similarity Track
Location :
Scaffold_131:40205- 46848
Transcript NameFunction/comments
Phyci_242386hypothetical protein

Sequence
6643 bases(100 bases per row)
GTGGGGGTGCAAGCTTCTACGGGTATGTGAACGAACTACGCAACGCTTTCGACCCCCACTCCGGGCTGCTCAAGAGCTGGCACCAGATTCTATTTGGCTG
TCTGCTGTACGAGGCTTTCTTGCTGCCTTTCGCTTCGACGTTCGCAGTCAAGTTTGCTCTGCCGACGTCGACGGTGGCGTTCCGTGCCTTCTACGCGGCG
GAAGTGCTCTTCCTCGCGGACTTTTACGTCAAGCTGAACACGGGGTTTTATGAGGCCGGCAACATCCACCGAGACACGCGCAAGGTGCGAGCCAAGTACC
TCAAGTCATTCGGCTTCTTGCTCGACGTCGTGGCCATCATACCGCTGTCGATAATCCTGCCTACGCCTATGGTCCCTGTTCCTTCGACTACTTCCGAGAC
AGCTTGCTGGCCTGGATGGTACGAGTTCCACAAAGTCCTGCGCGTTTGGCGCTTGCCTGGCTACTTCTCCAACCTGGACGACGTGTACGCGAAGTACTTC
CGCGCTCTCAAGCTGTTCAAGGTGCTAGTCGCTACGGCATTCGTGGCTCACTTCATAGCGTGCTGTCGATTTGCTATGGGCTGGAAGAGTGGTGTTGCAG
ACGCCTCAAACCCTTGGTTGCCCTCAGCAGCGCTGGGGAGTAAGCCCTTGGCTACCCAGTACGTTGGCGCGTTGTTCTGGAGTGTGGGGCTGCTTACCGG
GTCCTTTGAGGGGGCCTTGCCCCGCGGCAACACGGAGTTCGCGTTCACGCTCGCTGCTGTATTGCTGGGGTTTATGCTGTTCATTTACTCCAGCGCAACC
TTGTTCATGCTGTCAAAGTCGGAAAGCAATCAAACTGTTCTGGCACAGGCACGAATCAACCAATTGCGCCACCTTCTTACCTTCCACCACGTACCCGAGT
CGCTGCAGGTGCAGGCTGTCGAGTACCTCAAGCGCCACTACACGGACGCCGAGTCGAACGACCGCGAGGTCGTCAAACTGCTGTGTCCGTCTATCACGAA
GGATATCCAGGTGGAGCTTCTGAAGGACATGGTCGGTCGGATCCCGCTGTTCCGCGATTGCAACCAGCAATTCATTGTCGCGCTCACAAGTCTGCTAGAG
ATGACCAGCTTCCCAGCGCATGTCACGCTCTTTGAGGCTGGCGACCGAGGGGACTACATGTACGTTGTGAACTCCGGTGTGCTGCACATTCTGGTGAACG
GTGTGAAAGTTCGCGAGCTTCGTGTAGGAGCCTTCTTCGGAGAAATATCGGTGTTCTCGAAGCGACCGAGATCTGCGGCGGTCGTGACCACTTCGTATTG
TACTCTTTATCGTCTGTCCCGCTTCCACATTGAGCGTGTGCTCGAAGGCTACCCACACTACGCTGCCCAGATAGCTGCAGCGATCGACGAGATGGTCAAC
GAGAGAGATGCAAGAGCCGCACAAGGACAAGAAGCCGAAGAGTTCATGCTCACTACGTTGTATCAACTGTCTACTTCATCGCCGGTGAAAATACAGCGTC
GATCACTACGCGATCGAGCTAAGAGGGCGGTAAGTTTACGGCGAAGCAAATCTACACGAGTCGTGTCTGCTTCACGGCACGCCGAGTACGATGGGGGTAC
CATCTCCGTGAGCGAGAAGCGAGCTATCAATTTCCAGCCCACACCTATTTTGCTACCGCCCAAGGTCGCCCCGAAGAAGAGCCCCACCGGGAAGATGATA
CGCAGTCAGTCAGCATACGCTCGCCGATTATCGTCGGGGGTGAACTTGTGGCCTCACCCTGCTTTGAGTGTGAAGAGTACAAATGGTAACCATGGAGATA
GCATGCAAGGGTTTTATGACAATCTGGCACGGCGACGTGCAACACAGTTCCAAGCGGGCGACATATTGTCTAGACTGCTATCACGGCTTCTGATGCAGAG
GGTGATCGATCACACCGCAATGTGGCGGATGTACTGGCTGATTGCGCTGCAGGTTCACTTGGCAGCGAACTGGTTCGTCGCACCGCTCTTGCTTGCATTC
CCTGTATTGGATCGTCCTAGCACTCAGGCCAGCGTAAACACTACGTTTGCCATGCTGGATATCCTGTTAGTATTTGATATGTACTTGAACTTCCACTTGA
CCTACACCGCGGGCCGTAAGAAGATTGTGCTGAATTCGCTCACGGCGAAGCACTACTTGAGTGGTTCATTCATTCCAGACTTACTTTGCCTACTACCATA
CCGCCTAATGGTACCTCTCAGCGCTGCACCGATATTGACAACACACCCGGCGTTGCTGCGACTTCCACGGCTGCTACGGGCCTGGCATATTCGAGGCCAC
TTGAGGGAATGGGAAAACGCCTTTCGGCTCAGCAACACTTGGTGGTTGGTATGTGCTGGAATCGCGTATTTGCTGCTGTTGCACATTGTGACGTGTCTAT
ATTTCAGCTTCACGTACGTTGAAGGCTTTGGCAATACGAGCGACAACGAGCACCCGTGGCTACCATCAAGTGAACTGGAGTTGCGCCGCTACGTTGACCC
TAACGGAGTACCGTACTACACAGGGGGTTCGACCAACGTATCACTCACCGACGCGGAAGTGCGAAACATAGCCAGTATACAGTATATGCGCTCGCTTTAC
TTTGGAGCCACGATGCTCACGACGCTGGGCAAGACGGTCGAACCTTCGTCTGCGTTGCAGTACTCGGCCACGCTGGTTTTGATGCTGTGCGGCTTTTTTT
CGTTGGCATTGATGATTGATAGCGTTCAGAAGAGACTCACCGCGTCAGCCTTTGAGCAAAAGGAGTTTCTGGTGACACGTACGCGGGTTCAGCAGTTTAT
CAATTCACAAACTGCACCTACCGCAGTTCACCAGCGTGCGAAATCTTTCTTGGAGTTTTGGTGGTCTTGCCACCGTGGTGCCATTGCAAGCGAGCTGCTA
AGTGAGCTACCCGAGGCTATCAAACGACCGGTGGTGCGTAGCATGTGCCAGCCCGCACTACGGACGCTATCGTTGCTTGCCGATGTTCGACCGTGTCTGG
ATGCACTGGAGCAGGTGTTCATCGACAATATTCGCTTCATCCTTTACGGGCAAGGTGAAATTATCTACCGGCAGGGGGACTACGCCAGTGGTCTATTTTT
CCTGCTTGAGGGCGAGCTCATCGTCATCGTTAATGGCGGCATGCCTCGAACACTTGTAAAGGGAGGGTTTATTGGCACTGCCGCGCTAAATCTCAGTGAG
ACGTCTGTGAGCTACGCTGAGCGCGTGACAGCAGCAAGTGGTTGTATCCTCATTTTCATATCGAGAGAGAATTTGAATGGGATGCACAAGGTTTTCCCCT
CCTTTTCGATGGCGCTTCGAGCACTGGAGAAGCGGTTGGAAGGGGCGAAGCTGCCCCGTGCACAGCATGACTACAACAGTACGCGTGAACGTTCTTCTAG
TGGAGCCCTGCGTCCAATGCCTGTATCTAAACCATCATTGACATATGAGATGAAAGTGCTGCGGTATCTGGACCTCGATGATGTCATATTCGACCCGGAT
GAAAACATCGCAGCAGTGTGGGAACTTTGGACTTTTTGTCTGATCATTGCATTGTATTTGAAAGTCGTTGAAGACATTACAACGGGAGTCGAGAGCAGCC
ACGTGATCAATTCGGAGGTCGTTGCTGTGATTATTGAGATTTTCTTCGCGCTTGACTTTTACTTCCAGTCGCGTCTGGGCTACTATGAGTATGGCAACAA
AATCATGGATCTCGTGGCGATTCGGAAGCGTTTCTTTCGTTCGCATCGTTGTTACTGTGCAGCTCTCGCACTTTTCCCGCTATATGTCGTGAATTGGATG
CTGGGTTCCGCGCATCGATATGAACTTTTTAGTGTCAATAAGTTGCTGCGCTTATTTCGTGCTCCTATTATATTCGCGAAGCTTGAAAGTAAGTATCTCA
ACCGCACCGTGCAGTTGCGGTTGGCGAAGCTGGTTATCGTGTCACTCGTTATGTCCCACTTGTTTGGCTGCATCTGGCTTAACTTCAAAGACCCGGGCTT
TCAAAACGCGTGGATGCCATCGCCATCTCTCACAAAAGCAGATCCAGGAACACAATACTCGGCATTGTTGTTCTGGTCCTTCGGCATAATGTCGCACTCC
AATTCCGGAGAACTGCCGAAATCAGTGGAACAGTGTTTCTTCACCGTCGTAGTACTACTTGGAGGCGCCTTCCTTTTTGCTTTCGTGATAGGAAATATAT
CGGATGTGGTGGAGCTTGTAGATGCTGACTCGCGCGAGTTCAATGCCAAGCTCAGCTGTCTGAGGTTGTTGCTCGGACACTTCCACCTCCCGCTCGCAAT
AGAAGAGCAACTCAAGACTTATTTCTTCTTCCAGCGATATCATACGATCACTCAGGAGTATCTCTTGGAGCGCTGCTTGCCACCATCCCTTCTCACCGAA
ATTCGACTTGTTCACCTACAGCCCATGATCGTGAAAGTTGGTTTCCTTGCCGGTATGGAGGGATCTGTGACGCGGATGTTAGTCGCTCAGTTCGTTCAGG
CTCTCACTGTCAAAGACCAGTACGTTTTCCGGTTGGGTGAAGAAGGAAGCGATATGTTTTTCGTATTCACCGGAATTGTGGAAGTCTTGGTGCCGCTCGA
AACGCTGCAACGCCGCCAGTCAAATGACATGAAACTGTTTTCGTTGGGTTCTCCTTCTCGGTCTTCGTTCCGTACAGTCTTCCCCACCCTGGACCCGTCA
AAGCTGCAGGCCAAGGGCCAGCTGAAAAAAGTGAACGAGCTTACTAGCGGCTCGTATTTTGGCGAGGTCTCTTTGTTCACGAGTAAGCCTCGCAGTGCTC
ATGCTCGTTCGAAAACATCCTGTGTCCTCTACAAACTTTCAAGGCGGTCGCTCGAGCTCGTATTTGAAAGGTATCCAGACTGGAAGCGCAAGGTACTCAA
AATTGTCAACATCCAGCAGGAACAGCAGCTTTTGAGAAATCTCTACATGGAGGAGCAGCTTGATATCGCTGCGAATACCACGAAAAACATGCTGAACCAT
GTCGACGTTCTTGGTGACAGTGCGAACATAGGTCAAGCTAATAACGATCGCAACAGGTCAATGAGGAGTTCGGTAGGCAGTTTCTCGGAACGAACTACCT
CTGGACCACTACGACAACGTAACACGAGCACGAGACCTGTAGGCATAACCGCACTGAAGAGCGCAGGCTCCTTTTTCTCGTCCTACAAGGCACAGCGTTC
AGCGTCAACCAACATGGCGGTCTTGCAGATAAGTTCAAGGAAGAAGTCTGTGCTTTGGGTCGACATGCTTTTGCAGTGTACCGATGCGCAGAGCGCATTT
CATATCCAATGGCTTAAGATAATTGCCGCGAGCACGATCTACATGGCACTCGCCATTCCGTACCGAAACTCATTTGACGCGCTGGAGCGTTTGGGTCCGT
TCCCTATCGCCGCACGAGTCATCGAGTTGACATGTGAAGTTCTGTTCGGCTGGGATATCTGGGTGCACTGGAACCTGAAGGATGGCCTCGAGTCTATGGA
GCTCTACGAAAGCAAACAGCGCGATGCGTATCAGAAGGAGCGTCTGTGGATCGATATTGTGGCAGCTATCCCGATCGATCACTTTTTGTCGGACTTTTAT
CAATCGCCACTGCTGTGCATGAATCGATGCCTGAAGCTTTTCAACTTCCCGCATTACATGAAGGAGATCAACCGGCGCAGCGTGGCGTACGAGAAGTACC
GCTTTTGGACACTCTGGGTCTTGTTCTTCGTTCTCTTGCACTGGTGTGCGTGCGCCTATTTTTCCTTAGCATCAGCTACAGTCAGCTCGGATACGGCAGG
AAGTGAGAGTTGCTGGGACAATTGGTCTCCGCCACGTAGCGCACTGAGCATTTCCTGGACGGACCCATCCTTGGACTTACTCATGCTTCGATTCCTGCGT
GGGTTATTCTTCGCTTCCACCGCTTTCATCAAGAAAGGAAAAGTCTTCGAACCAAGTGACCACGCCGACTACCTATTCACCCTTTTCGTAGACTTTGTCG
GCCTCGTGACGATGGCATTCATGATCGGGGAAATGGCAAACCTCTACATCTCGTACATCAGCAATGAAGTGGAATTCCGAAAGAATCATATTGCAGTGGA
GTTATACCTGGAGCGCTGGCACATTACAGGGAAGCTGCGTGCTCGGTGTCACGCATTTTTGTCGTCGTTATGGAGCTCTCACCGAGGCGTGAACTACCAG
GCTATCTTCGATGAGATTCCGCTAATCATTCGGACGGAGTCGATCCTGCACATCGCCAACTTACCATTGCGTGCTTTCATCAATAGCGTTTTCCGGCCTT
TTGCCACTGCTCACCCTCACGACCGAGACGTGGAAGCACTTACACGTTCAATCGCCCAGCATCTCAAGTACGAAGGCTACCCTCGCGACGAATGCGTACT
AGTGGAAGGAAGAGTCTCGAACGAGATGTACTTCGTCGTCAAAGGCCACTTAATTGCTACCACCAGCGCTGATCGCCCAGAACACTCGATTCGATCCGAC
CAGCACTACAAGAAGGGAGACTTCTTCGGGGAGCACGGTCTGCTGGGATATTCTGTCGGAGTGTGCACAGTCAAGACTGTATGTGCATGTGACTTGCTGT
CGCTCAGCTCTGAATCGTTGTTGGAAGTGATTCTTTCACGGCC