Description :
From Genome Similarity Track
Location :
contig_14:402041- 403638
Transcript NameFunction/comments
g2991.t1hypothetical protein

Sequence
1597 bases(100 bases per row)
GAGATGGCGGCAAAGCTCAGTCTGCCCAACTCCGTCACGCACCAAGAGATCGTCACACGAGTGCAGGCGGTCATTGACGAGATGGGGCTGCGAGTGTGCG
AGCACACACTGGTCGGGGATATCTTCCGCAAGGGCATTTCGGGCGGCCAGAAGAGGCGGCTAAGTATCGCCATTGAGCTGCTATCGGACCCGTCCATCTT
GCTGCTGGACGAACCGACCTCGGGGTTGGACTCGGCCTCGACGCACAATGTCATGCAGTTCGTGTCGAGGTTGTGTCGAGAGAACAAGACGGTGATCTGC
ACGATCCACCAGCCTTCGTCGCTCGTGTACAACATGTTCACGAACGTGGTTATCCTCACGGCAGGCGAGACGGTCTACTTCGGCCCTCGAGAGCCCACCA
TCGACCATTTCTCGGCTGCTGGCTACTCGTGTCCGATGTACATGAACCCGGCGGAATACTTCATCAGTTTGGTGAACTCGGACTTTGAGGGCCACGCTGA
CATCAAGCGCCTCGTGGCCAGCTACGCCAGCAGCGCGATGGCTTTGAAAGTCGTCGACAACATCGAGGCGGACGCTGCGGGAGTCCACAACGCGACCCCC
GTCGTCCCAGTCAAACCTTCGGCGCTACGCCAGTTCTGGGTGCTCATGCAGCGCAACTCGCTCAACAACGTTCGCAACCCGGGTATTTACTGGGTCCGAC
TCGCCATGTACACCATGCTATCGTTCATGGTGGGCACCATGTACCTCTCCACCAACGACGCCATCTCCGACGAAGACATGGTGCCATTGCTCTTCTACGT
GCAAGCCTTCCTGGTCTTCATGTCGGTGGCTGTGCTGCCTTTCTTCATTGAACAGCGGGCGGTGTTCCTGCGGGAGCGTGCGAATAGCGGCCTCAACGTC
TTCAGCTTTGCGCTGGCGAACTTCATCGCGACTCTCCCCGGCATCTTTGTGATTGCACTCGTGTCGACGCTGCTCGTGGTTCTGCTCTCGGGTCTCAACG
GGTTCTGGTACTTCCTGTTGAACCTGTTCCTGTCGCTGGTAGTGGCCGAGTCGCTCATGCACGTGATCGGAGCCGCTGTCCCGCACTATATCATCGGCAT
CGCTCTGGGAGCAGGCATCTACGGCATGTTCATGCTGTGCGAGGGCTTCATGGTGCCGAAAGACGTCATCCCGGACTACTGGATCTGGGCCTACTACATC
GCCTTCCACTCGTACTCGTTCAAGTCGTTCGTGTACGAACACTTCATCCACGTGGACACCCCGGCAGCCAAGGCGATTCTGGCGCGACTGAACCTCGAGG
ACGTCGACACGCCGCAAAACATGATCATCCTGGCGTGCTACGCCATCGGCCTGGAGCTCATCTTCACCTTCATCCTGTACAAGTTCCACACTGGGCGTAG
GTAATCTAGACGTACTAGACGATGAGAGAAGTGGGTGGAAGTTACTTTGAAGGATATCCTACCAAGCACAATTCAAATGTTTGAGGCAACATGTTGTGCG
TTTCTGTAGCTGGAAATGTCCGTCAACCCAGTCTGTCGGCCTCAACGCCAACGTCACATCTGCATCAACCATATTCTTGTTGGTGTTTCGAGCAGAA