Description :
From Genome Similarity Track
Location :
contig_20:40203- 42075
Transcript NameFunction/comments
g4178.t1hypothetical protein

Sequence
1872 bases(100 bases per row)
GTCGTTGGAGTCTCGACTAGGACGGCGTTGCTCCTGATCCGAATGCGATCTGGTCGGCTGATCGGGCGTTGCCGCGAAGTACCCTTGCGTAGGTCTCCCT
CACCCTCCGATCCGCTGGTTTCCAATTCGGAGTCGCTCGAGTTGACTGTGTGCGGATTGCGCGGACTGCGCGGCATTCGCGGATGGGGTGATTCCCGTGG
GTGATTTCTGCTTGGGTTTGATGGACCCATACACCGTCTTTCCTTGTCTCGCCTTCGCACGTTGTCGGGATCGCAGTGTCTCTTCGAGAGTGTCTGCGTC
CGGAATTCTTAGCAGTGCCAGTTGGCTGGCTAGATCGCGATCGTCGAGTGTTTCGATGAAGTGATCGACATGTTCACGGCGGACCTCAATCGATCCATCC
TTGATCGAGAGCTGAGCTCGCAAACCAGCGACATTCAGACGGTGCAGATATTCCAGCGGCGATTCATCCGATCGCTTTCGCGCATGGTAGTATTGTCTCG
CGACAGACACGCCACGTCCGCAGTATTGAGTCTGGAAGTTCTTAGACAAGCTCTTCCAGTTGCCGCGCGCGTCCGACTCAGCTGTCGGTACCAGTTACGT
GCGGGTCCAGTGAGCAGATCTACAAACACCAGACACTTCGCCATCAGGAGCTTGAACGCGGACAAAGACAGACTTCAGTTTGCCGAACCAGCTTCTGGCA
CGATCTTCGTCGTTATCCTTCCCCGAAAATTCCTTCAGTTCTGAGATCGCGGAGACTCGGATCCTTGTGGCTGAGAGTGTTCCGCCGCCTGTAGTCCCAG
CAGATGCGACTGCGGCACGAGGGGTAGCGTCGACACCCAGGTCATCCGGATCGTATTCGCTCGGGTGCGAATGGTCCCGGCGATTCGACTCCACGGACTC
CATGTCAACGTCTTGAGCTCCAGGTGGCTTGGTTTGGTCGACGACTGGCGTGGTCGAGACCGCTTGCTGTTCCTTCAGGAAACGCTCCATTGCTGCATTG
AAGAACGATTGCATGCGTTCAGGGGAGCTTGGGCTGGATCGCTCGTCGCGATAACTGTCGGCTTGGTTTCCGATCTCTCCTTTCGCGACTGTAGCATGGC
TGCTCCGGCCGGCCCAAGTGTCATCCGCTGCAGCTCGATCGAGCTGTCCGATCCCGCTTCGGATGTGGCTGAGGCATATTGCGACGATCCGGTTTGGCTG
CGAGTCGGTGCTGGTCTTTCACGTTGAACCGGGACGACACTACCGACAAGGGGCGTCAGCTTCGCGAACAGGCTCAGCGTTGATTCCTGATGATTGGCAA
TTCCAAGTCGAATAGCTCGTTCGCGTCGAAGGAGCCGAGCACGATTCCCGCTTCTTTCAGCATGCGCATCAGCAGTTTCACTGCCTCGAGTTGGCTGGTT
ACTTCCTTCGGTGCCTTCACTGGACCTTGCAGTTCCCCGATTGGCTTCGGGCGCACGATCTTCATTACAGGGTCTTCGTGCAGGAACTTGTAAAGGTCCT
TGTAGAAGAAGGCAGACTCCAGTTGCTCGTCCGTCCACGTGTTGCAATCCTCCTGGTCTTCGGCTTCAGACTCCGGTGCCTTCAGCTTCTTGCGTGAGGT
CTTCGACTTCTTCTTCTCTCGAGGTTGCGTGCGGAACTGGAGGAGTGGTTTTGGATGAAGGTCCTTCGGTTTTCACCGTCGGACCTTCGTCCGGCGGATC
ACGATTCGCATCGCGATCCGCGGGGGTCCCCGAGGGGACCTGGGGAGGGGTTTGAGGCTTTTCTTCTAGGTCCATCGCTGAACCTTCCTCTTTCACATCG
TCAGAGCTCCTCCCGGCACTCTCACGATCAGTGGATCCTGGCGCTTTCAGCGCCGTCGGCGCGATCCTTCTT