Description :
From Genome Similarity Track
Location :
Scaffold_498:4020- 6121
Transcript NameFunction/comments
Phyta_totarag8823hypothetical protein

Sequence
2101 bases(100 bases per row)
AACCGTTTGCCCTTCTTGGAGCTCCTCGCCGCGAGCGGGACCTTCCAGATTTCACAATGCCGCAGCTATCAAATCACTGACGATTAGTATGTTTGTATGC
ACTTGTCCTGCGTGGTGCATGACGATTCGTCTTGGTGCAGGTCGTGTCGGACATTGGCCGCGAGtacggcgtcgacgtcgagccCAGCTCCAAGTATGCA
TGGGTAAGTGTCAAAGACATTCGTATAGCGTTCGCTGAACTTTCTAGCCCGAATCTTGGCTACTACCACCAACGGTGGACCATCGCTTAGTTAGCCATGT
TGCACGAGTTAACTCAACTGCTGGCCGACTTGGGCAGCGCCTTCCGCTCACTCTTACGACTGACTGACGTGATCTGCTGTCTCTGACCACTGGCTATGTC
TATGAAGATGGAGAAAGGCGGTGCCGCTGTTGCACTAggcgacgagcagctgcacggGAAGCACGGgggcgacgacagcgacgacgtgcgcCGCATCCTG
CGCGAGCTCCAAGTCTCAAGGCTCCAAGTgcgtcaactgcagcaagtcgtggacgagctgcgcgacgagCAACGCGTTTcgaagcagcgcgtggcGCTCT
TTGGCACGTTGTcggccaagctcaagcgcgATCTTGTAGACGAACGACTGGCGCTCATCGACGCCAAGAACGAGATCAAGGAATtgcgacgcagacgcag
cggaGACGACACCGGTTcaggcggcggaggtggccGCTCTCCACAGTCTCCATCTCTGCAAGAACAAAGTGAGAACCCCTGGAGCTCGCCGAACAAGCCC
ATTGCCGGCTCTGCTGGCGGTGCAAGTGGGTCGGGGGCTACTGGCGGTGCTTCAGGAGGAGCGAGTCTCATGGCATTCAACTTTTATCCATCGGCATCGT
CTCGAGGTGCAGGTGACCAAGAgggcgccgacgacgacgagcctCCGTCCCCCTCCTCGAGCACACAGACACTCCGAAGCACACTCATGGGCCAGTTCTT
GCCGTCGGCATTGCTGGATTCTCCACAAGTTACACCCAAACACGCCAGACCATTCGCCGGCGACACGCTcaacgaggagaaggtgccgCCTCCTATTTCT
CACCTCAATGACGACATGGAATCGCTGTCGCTCACAGCACCACCCctgccagcagcttcggcgacTAGTTCGACAGTAAATCAGCAGCAAGGCACATCCG
ACGATGCAGGAGACGAACCAAAGGAGACAAGCCAGAGCGACAGTGGGAGGCTGTCGACGCCTTCGGCAGTGTCGCCACTgaagctgtcggtgctgtcggA
ACTTTTCGACGCTATCCCggtggaggagttggagaCAATTTTGCAGCGCTTTGATGGCCAGGAATCAGCAGCCATTGACTACATTTTGAGCACTCACCCA
AGCTTCAATCCAgcacttggagctggaggaagagtAGAGAGCGGCAGTGGTTTGGCATCGATGGCGTCCCCTTCGCCGTCTCGATCATCTTCAGTTGGAC
ACAGCAAAACTAGCTTgcaccgcagcagcagccagagcgGACCGAGCGGACCTCCACCAGGATCTTCAAGCAACTGGAAGACGGAGATTTGCATGTACTA
CATGCAAGGTAAATGCAACAAGACGAGGCGTACCTGTTCATTTGCCCACGGCGAGAGTGATCTGATGCGTCCTAGCGGCTCgagcggcggtggtggtagC
AGCAAGCACGGACCCAGCTACAAGACTCGACTTTGCCAAGCTTACGAAAATGGCACGTGCACGAAGTCACGTCGTGATTGTCCGATGGCTCATGGCGTGA
ACGACCTGCGGGacggaggtgctggaagtGGCGGTAATGGAGGCAGCCAGCCGATTCTGTCTCCTGCGACTCCAAGATTGCAGAGTTACAAGACCGAGCT
GTGCTACTACTTCTTGAAGGGGAACTGCAACTACTCGAAAGAGGAGTGCCGCTTCGCACACGGTCAAAGTGACTTGCGCACGGTGGAGAGCAATACGGCG
catattgctgctgcagctgtggtAGTCGGCGGCTCCAGTTTTGGCGGCGATTATGGCCCGACGTCACCTGTCCCGCCACCACCGGCCGTCtcgatggaga
a